Incidental Mutation 'R6150:F2rl3'
ID489193
Institutional Source Beutler Lab
Gene Symbol F2rl3
Ensembl Gene ENSMUSG00000050147
Gene Namecoagulation factor II (thrombin) receptor-like 3
SynonymsPAR4
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6150 (G1)
Quality Score189.009
Status Validated
Chromosome8
Chromosomal Location72761880-72763874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72762738 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 198 (A198S)
Ref Sequence ENSEMBL: ENSMUSP00000054426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004494] [ENSMUST00000058099]
PDB Structure
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR4 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000004494
SMART Domains Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 2.5e-19 PFAM
Pfam:PAH 173 227 4.4e-20 PFAM
Pfam:PAH 313 357 1.6e-8 PFAM
HDAC_interact 384 484 2.75e-58 SMART
low complexity region 667 688 N/A INTRINSIC
Pfam:Sin3a_C 712 1011 7.2e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058099
AA Change: A198S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000054426
Gene: ENSMUSG00000050147
AA Change: A198S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2PV9|C 51 76 5e-12 PDB
Pfam:7TM_GPCR_Srsx 100 367 4.1e-8 PFAM
Pfam:7tm_1 106 352 7.6e-37 PFAM
low complexity region 369 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213063
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a member of the protease-activated receptor subfamily, part of the G-protein coupled receptor 1 family of proteins. The encoded receptor is proteolytically processed to reveal an extracellular N-terminal tethered ligand that binds to and activates the receptor. This receptor plays a role in blood coagulation, inflammation and response to pain. Mice lacking a functional copy of this gene exhibit impaired platelet activation and prolonged bleeding times. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene results in prolonged bleeding time and protection against thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in F2rl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0276:F2rl3 UTSW 8 72762798 missense probably benign
R0748:F2rl3 UTSW 8 72762751 missense probably benign 0.00
R1640:F2rl3 UTSW 8 72762906 missense probably benign 0.13
R3123:F2rl3 UTSW 8 72763212 missense probably damaging 1.00
R4546:F2rl3 UTSW 8 72762583 missense probably benign
R4718:F2rl3 UTSW 8 72762908 missense possibly damaging 0.61
R5000:F2rl3 UTSW 8 72762679 missense probably damaging 1.00
R6195:F2rl3 UTSW 8 72762885 missense probably benign
R6233:F2rl3 UTSW 8 72762885 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCTCATGAACCTGGCAG -3'
(R):5'- TCTGAGTGCATGGCTGTAGC -3'

Sequencing Primer
(F):5'- ATGAACCTGGCAGTGGCTGATC -3'
(R):5'- CACGAAGGGTGGCTCCATAG -3'
Posted On2017-10-10