Incidental Mutation 'R6150:Tmem184c'
ID489194
Institutional Source Beutler Lab
Gene Symbol Tmem184c
Ensembl Gene ENSMUSG00000031617
Gene Nametransmembrane protein 184C
SynonymsTmem34, 8430433H16Rik
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location77595982-77610698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77596440 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 598 (Q598K)
Ref Sequence ENSEMBL: ENSMUSP00000034030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034030]
Predicted Effect probably benign
Transcript: ENSMUST00000034030
AA Change: Q598K

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034030
Gene: ENSMUSG00000031617
AA Change: Q598K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Solute_trans_a 48 317 1.9e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
internal_repeat_1 422 485 1.18e-11 PROSPERO
low complexity region 500 512 N/A INTRINSIC
internal_repeat_1 519 599 1.18e-11 PROSPERO
low complexity region 600 621 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Tmem184c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Tmem184c APN 8 77597146 nonsense probably null
IGL02024:Tmem184c APN 8 77604814 missense probably benign 0.10
IGL02231:Tmem184c APN 8 77604812 missense probably damaging 1.00
IGL02736:Tmem184c APN 8 77597846 missense probably damaging 1.00
IGL02934:Tmem184c APN 8 77597820 missense probably damaging 1.00
IGL03046:Tmem184c UTSW 8 77599657 nonsense probably null
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0189:Tmem184c UTSW 8 77597812 missense possibly damaging 0.92
R0564:Tmem184c UTSW 8 77606160 unclassified probably null
R0946:Tmem184c UTSW 8 77604757 missense probably damaging 1.00
R1629:Tmem184c UTSW 8 77602922 missense possibly damaging 0.87
R1629:Tmem184c UTSW 8 77606162 critical splice donor site probably null
R2261:Tmem184c UTSW 8 77597043 missense probably damaging 1.00
R2261:Tmem184c UTSW 8 77597175 missense probably damaging 0.99
R2919:Tmem184c UTSW 8 77604647 missense probably damaging 1.00
R3805:Tmem184c UTSW 8 77596875 missense unknown
R5418:Tmem184c UTSW 8 77597820 missense probably damaging 1.00
R5716:Tmem184c UTSW 8 77606407 missense possibly damaging 0.90
R5934:Tmem184c UTSW 8 77604723 nonsense probably null
R5951:Tmem184c UTSW 8 77598662 splice site probably null
R7206:Tmem184c UTSW 8 77596577 missense possibly damaging 0.46
R7387:Tmem184c UTSW 8 77597930 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAACATTAGATTCATGCAGTGG -3'
(R):5'- TCATGATTAACATCCCAGAAGAGC -3'

Sequencing Primer
(F):5'- TGTTTAAGAAAGTCAAAGCCTAGG -3'
(R):5'- CCAGAAGAGCAACAAAAACTTATTG -3'
Posted On2017-10-10