Incidental Mutation 'R6150:Myb'
ID489200
Institutional Source Beutler Lab
Gene Symbol Myb
Ensembl Gene ENSMUSG00000019982
Gene Namemyeloblastosis oncogene
Synonymsc-myb
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location21124935-21160984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21141769 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 641 (I641T)
Ref Sequence ENSEMBL: ENSMUSP00000139699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020158] [ENSMUST00000188495]
Predicted Effect probably damaging
Transcript: ENSMUST00000020158
AA Change: I522T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020158
Gene: ENSMUSG00000019982
AA Change: I522T

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 267 313 4e-29 PFAM
Pfam:Cmyb_C 399 559 1.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186446
Predicted Effect probably damaging
Transcript: ENSMUST00000188495
AA Change: I641T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139699
Gene: ENSMUSG00000019982
AA Change: I641T

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 266 313 3.6e-32 PFAM
low complexity region 409 421 N/A INTRINSIC
Pfam:Cmyb_C 516 682 8.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216985
Meta Mutation Damage Score 0.2682 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for deficient alleles of this gene display severe hematopoietic abnormalities. Red and white blood cells and platelets are all affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Myb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Myb APN 10 21141826 missense probably damaging 0.99
IGL00707:Myb APN 10 21148384 missense probably damaging 1.00
IGL00796:Myb APN 10 21141799 missense probably benign 0.00
IGL01012:Myb APN 10 21146260 missense probably benign 0.03
IGL01082:Myb APN 10 21152944 missense probably damaging 1.00
IGL01365:Myb APN 10 21152502 missense probably benign 0.31
IGL01906:Myb APN 10 21152634 missense probably damaging 1.00
IGL02560:Myb APN 10 21152448 missense probably damaging 1.00
Huang_river UTSW 10 21152617 missense probably damaging 1.00
PIT4495001:Myb UTSW 10 21152622 missense probably damaging 0.98
R0385:Myb UTSW 10 21154712 missense possibly damaging 0.73
R0442:Myb UTSW 10 21126196 missense probably benign 0.05
R0759:Myb UTSW 10 21145028 missense probably benign 0.01
R0882:Myb UTSW 10 21156360 missense possibly damaging 0.75
R0920:Myb UTSW 10 21126234 missense possibly damaging 0.80
R1401:Myb UTSW 10 21152945 missense probably damaging 1.00
R1651:Myb UTSW 10 21126198 missense probably damaging 1.00
R1752:Myb UTSW 10 21156437 missense possibly damaging 0.89
R1879:Myb UTSW 10 21141977 missense probably benign 0.24
R1971:Myb UTSW 10 21140656 missense probably benign 0.00
R4355:Myb UTSW 10 21152617 missense probably damaging 1.00
R4611:Myb UTSW 10 21145324 missense probably damaging 1.00
R4650:Myb UTSW 10 21152941 missense probably damaging 1.00
R4888:Myb UTSW 10 21126238 missense probably benign 0.01
R5121:Myb UTSW 10 21126238 missense probably benign 0.01
R5922:Myb UTSW 10 21152927 missense probably damaging 1.00
R5955:Myb UTSW 10 21152499 missense probably damaging 1.00
R6116:Myb UTSW 10 21154754 missense probably damaging 1.00
R6207:Myb UTSW 10 21145322 missense probably benign
R6656:Myb UTSW 10 21152945 missense probably damaging 1.00
R6801:Myb UTSW 10 21144966 splice site probably null
R6824:Myb UTSW 10 21145120 missense probably benign 0.00
R6884:Myb UTSW 10 21152532 missense probably damaging 1.00
R6977:Myb UTSW 10 21152652 missense probably damaging 0.96
R7562:Myb UTSW 10 21141754 splice site probably null
R7651:Myb UTSW 10 21156374 missense probably damaging 1.00
R7747:Myb UTSW 10 21156425 missense possibly damaging 0.89
R8346:Myb UTSW 10 21126237 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGTATAAGCCCGCTGCC -3'
(R):5'- GGGCTTAGGAGTGTAGACAAGTTTC -3'

Sequencing Primer
(F):5'- GCATCTTTTCTGCCTAAAGAAGTTG -3'
(R):5'- AGACAAGTTTCCTCTGATCTGG -3'
Posted On2017-10-10