Incidental Mutation 'R6150:Olfr399'
ID489205
Institutional Source Beutler Lab
Gene Symbol Olfr399
Ensembl Gene ENSMUSG00000043692
Gene Nameolfactory receptor 399
SynonymsGA_x6K02T2P1NL-4211516-4210581, MOR255-1
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74053127-74056615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 74054319 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 147 (S147A)
Ref Sequence ENSEMBL: ENSMUSP00000149917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059440] [ENSMUST00000206280] [ENSMUST00000215915]
Predicted Effect probably benign
Transcript: ENSMUST00000059440
AA Change: S147A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056508
Gene: ENSMUSG00000043692
AA Change: S147A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.9e-55 PFAM
Pfam:7tm_1 44 293 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125093
Predicted Effect probably benign
Transcript: ENSMUST00000206280
Predicted Effect probably benign
Transcript: ENSMUST00000215915
AA Change: S147A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Olfr399
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Olfr399 APN 11 74054475 missense probably benign 0.41
R1344:Olfr399 UTSW 11 74054212 nonsense probably null
R1496:Olfr399 UTSW 11 74053824 makesense probably null
R1708:Olfr399 UTSW 11 74053988 missense probably damaging 0.99
R1911:Olfr399 UTSW 11 74054384 missense probably damaging 0.99
R2056:Olfr399 UTSW 11 74053993 nonsense probably null
R3418:Olfr399 UTSW 11 74053988 missense probably damaging 0.99
R5444:Olfr399 UTSW 11 74053977 missense probably benign 0.19
R5470:Olfr399 UTSW 11 74053907 missense possibly damaging 0.90
R6442:Olfr399 UTSW 11 74054679 missense probably benign 0.00
R6687:Olfr399 UTSW 11 74054384 missense probably damaging 0.99
R7195:Olfr399 UTSW 11 74054397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGCTGCTACAAAGAGC -3'
(R):5'- GGATGCATTAGTGTCACTGTTCC -3'

Sequencing Primer
(F):5'- GCTGCTACAAAGAGCAGCTGC -3'
(R):5'- ACTGTTCCTGCCATGTTGAAAC -3'
Posted On2017-10-10