Incidental Mutation 'R6150:Tex2'
ID489207
Institutional Source Beutler Lab
Gene Symbol Tex2
Ensembl Gene ENSMUSG00000040548
Gene Nametestis expressed gene 2
SynonymsDef-5, Taz4, 4930568E07Rik
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106502147-106613423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106567080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 508 (V508D)
Ref Sequence ENSEMBL: ENSMUSP00000099359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042780] [ENSMUST00000103070] [ENSMUST00000128933] [ENSMUST00000153870]
Predicted Effect probably benign
Transcript: ENSMUST00000042780
AA Change: V508D

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041985
Gene: ENSMUSG00000040548
AA Change: V508D

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
low complexity region 811 823 N/A INTRINSIC
low complexity region 946 965 N/A INTRINSIC
low complexity region 1003 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103070
AA Change: V508D

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099359
Gene: ENSMUSG00000040548
AA Change: V508D

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128933
SMART Domains Protein: ENSMUSP00000120781
Gene: ENSMUSG00000040548

DomainStartEndE-ValueType
low complexity region 119 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153870
Predicted Effect unknown
Transcript: ENSMUST00000207249
AA Change: V10D
Meta Mutation Damage Score 0.3415 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Tex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tex2 APN 11 106568535 missense probably damaging 1.00
IGL01380:Tex2 APN 11 106544315 nonsense probably null
IGL02607:Tex2 APN 11 106546747 missense unknown
IGL02680:Tex2 APN 11 106568232 unclassified probably benign
IGL02699:Tex2 APN 11 106568433 missense possibly damaging 0.53
IGL03187:Tex2 APN 11 106568077 unclassified probably benign
IGL03398:Tex2 APN 11 106568272 missense probably damaging 1.00
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R1085:Tex2 UTSW 11 106568487 missense probably damaging 0.98
R1491:Tex2 UTSW 11 106503640 missense possibly damaging 0.72
R1664:Tex2 UTSW 11 106567782 unclassified probably benign
R1794:Tex2 UTSW 11 106567902 unclassified probably benign
R1855:Tex2 UTSW 11 106546876 missense possibly damaging 0.87
R2077:Tex2 UTSW 11 106506864 splice site probably null
R2151:Tex2 UTSW 11 106567335 unclassified probably benign
R2175:Tex2 UTSW 11 106503687 missense unknown
R2984:Tex2 UTSW 11 106546663 critical splice donor site probably null
R3156:Tex2 UTSW 11 106533869 critical splice donor site probably null
R3722:Tex2 UTSW 11 106546740 nonsense probably null
R3724:Tex2 UTSW 11 106529330 missense unknown
R3770:Tex2 UTSW 11 106544252 missense unknown
R3771:Tex2 UTSW 11 106546894 missense unknown
R3813:Tex2 UTSW 11 106511944 missense unknown
R3947:Tex2 UTSW 11 106520003 missense unknown
R4206:Tex2 UTSW 11 106567572 unclassified probably benign
R4342:Tex2 UTSW 11 106567006 unclassified probably benign
R4554:Tex2 UTSW 11 106544386 missense unknown
R4896:Tex2 UTSW 11 106568404 missense probably damaging 1.00
R5207:Tex2 UTSW 11 106546840 missense unknown
R5249:Tex2 UTSW 11 106546789 missense unknown
R5257:Tex2 UTSW 11 106567759 unclassified probably benign
R5258:Tex2 UTSW 11 106567759 unclassified probably benign
R5278:Tex2 UTSW 11 106567813 missense probably benign 0.34
R5702:Tex2 UTSW 11 106544395 missense possibly damaging 0.58
R5835:Tex2 UTSW 11 106519913 missense unknown
R6785:Tex2 UTSW 11 106533950 missense probably damaging 1.00
R6879:Tex2 UTSW 11 106534010 missense unknown
R7038:Tex2 UTSW 11 106511900 critical splice donor site probably null
R7117:Tex2 UTSW 11 106544245 missense unknown
R7336:Tex2 UTSW 11 106548859 missense unknown
R7568:Tex2 UTSW 11 106548736 missense unknown
R7622:Tex2 UTSW 11 106546895 missense unknown
T0970:Tex2 UTSW 11 106546946 missense unknown
Z1177:Tex2 UTSW 11 106534008 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCGATTCGAACACCTTCAG -3'
(R):5'- TGATAAGACCCTCGATCTCCCC -3'

Sequencing Primer
(F):5'- GATTCGAACACCTTCAGCCATCAG -3'
(R):5'- TCAAGCCAGAGGTGCTTG -3'
Posted On2017-10-10