Incidental Mutation 'R0526:Blm'
ID48921
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene NameBloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 038719-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0526 (G1)
Quality Score111
Status Not validated
Chromosome7
Chromosomal Location80454733-80535119 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 80505893 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 346 (S346*)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
Predicted Effect probably null
Transcript: ENSMUST00000081314
AA Change: S343*
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: S343*

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166096
Predicted Effect probably null
Transcript: ENSMUST00000170315
AA Change: S346*
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: S346*

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205263
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,455,224 N230I possibly damaging Het
4933427D14Rik G T 11: 72,169,783 Q687K probably damaging Het
Actrt2 A G 4: 154,667,412 L89P probably damaging Het
Adamts1 A C 16: 85,802,372 S113R probably benign Het
Agxt2 G T 15: 10,373,862 C118F probably damaging Het
Akap8 G A 17: 32,317,292 T49I probably benign Het
Alk A T 17: 71,869,753 W1519R probably damaging Het
Atf7ip T A 6: 136,559,805 F12Y probably damaging Het
Atp13a5 A G 16: 29,348,740 C131R probably damaging Het
Atp8b4 A G 2: 126,427,363 L168P probably damaging Het
Ccnt2 T G 1: 127,799,445 C199G probably damaging Het
Cd151 A T 7: 141,470,591 H219L probably damaging Het
Cd200r2 A T 16: 44,915,047 R248S probably damaging Het
Cdh3 A G 8: 106,555,446 D822G possibly damaging Het
Clec4b1 T C 6: 123,069,770 probably null Het
Cluh C A 11: 74,665,986 L951I probably benign Het
Cog7 A T 7: 121,963,271 probably null Het
Col25a1 C A 3: 130,476,394 P197Q probably damaging Het
Csde1 T A 3: 103,056,426 S636R possibly damaging Het
Ect2l C A 10: 18,199,940 C66F possibly damaging Het
Elac2 T C 11: 64,999,436 M671T probably benign Het
Evi5 T C 5: 107,821,748 N143S probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fbxo38 A G 18: 62,505,980 Y1084H probably damaging Het
Fcgr4 T A 1: 171,029,191 L209Q probably damaging Het
Fgd3 C T 13: 49,296,524 S83N probably benign Het
Gigyf2 T A 1: 87,421,493 M664K probably benign Het
Gm38394 T C 1: 133,658,734 I288M probably damaging Het
Il27ra A T 8: 84,039,499 S219T probably benign Het
Kif15 T C 9: 122,997,797 V800A probably damaging Het
Lmo7 T A 14: 101,900,560 D666E probably damaging Het
Lrp5 T C 19: 3,628,295 D520G probably damaging Het
Lrriq3 T A 3: 155,188,297 M545K probably benign Het
Lsm5 T A 6: 56,703,325 D44V probably damaging Het
Man1c1 G T 4: 134,569,068 Y430* probably null Het
Map4 T A 9: 110,037,278 probably null Het
Megf6 A G 4: 154,258,941 K561R probably benign Het
Myo1e T C 9: 70,322,398 Y173H probably damaging Het
Myo6 T A 9: 80,283,541 S791R possibly damaging Het
Nol11 C A 11: 107,184,771 E144* probably null Het
Ntng2 C T 2: 29,197,062 R416Q probably damaging Het
Nxpe3 T A 16: 55,866,517 I43F possibly damaging Het
Olfr1093 A T 2: 86,786,347 T206S possibly damaging Het
Olfr1284 T A 2: 111,379,492 V164E possibly damaging Het
Pkd1l2 T C 8: 117,082,260 I64V probably damaging Het
Prf1 G A 10: 61,300,254 R103H probably benign Het
Rest A G 5: 77,281,027 D431G probably damaging Het
Serpina10 A T 12: 103,616,868 L439Q probably damaging Het
Sgk3 T G 1: 9,881,579 V176G probably damaging Het
Slc19a3 A G 1: 83,022,733 S188P probably damaging Het
Sorbs1 A G 19: 40,349,948 I336T probably damaging Het
Ssfa2 A G 2: 79,657,346 D591G probably benign Het
Strip1 C T 3: 107,620,039 probably null Het
Syt4 T C 18: 31,443,746 E185G possibly damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tgfbr3l G T 8: 4,249,439 R74L possibly damaging Het
Thoc7 A G 14: 13,949,282 M194T probably benign Het
Thsd7b T C 1: 129,951,392 Y989H probably damaging Het
Tmem156 C T 5: 65,075,818 V134I probably benign Het
Tnks A T 8: 34,853,303 V738E probably benign Het
Trpm6 A T 19: 18,792,876 I342F probably damaging Het
Vmn2r69 A T 7: 85,411,503 V291D probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wnk1 T C 6: 119,951,992 T1292A probably damaging Het
Yes1 T A 5: 32,655,240 C285S probably benign Het
Zbtb49 T C 5: 38,213,919 N206S probably benign Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 splice site probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 splice site probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
R8500:Blm UTSW 7 80455284 missense probably damaging 1.00
R8543:Blm UTSW 7 80494216 missense probably damaging 0.98
R8749:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512910 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512907 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512918 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512919 small insertion probably benign
R8775-TAIL:Blm UTSW 7 80512931 small insertion probably benign
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCACAGAGGCCCTGGGTTTAATC -3'
(R):5'- TGCAGTGCAAGGAGCTAAGCAGTC -3'

Sequencing Primer
(F):5'- CCTGGGTTTAATCCCAGCATTAAAG -3'
(R):5'- gggaggggagacaggaag -3'
Posted On2013-06-12