Incidental Mutation 'R6150:Erc2'
ID489211
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene NameELKS/RAB6-interacting/CAST family member 2
SynonymsELKS2alpha, D14Ertd171e
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location27622428-28478537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 28141291 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 491 (S491Y)
Ref Sequence ENSEMBL: ENSMUSP00000147744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]
Predicted Effect probably damaging
Transcript: ENSMUST00000090302
AA Change: S821Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: S821Y

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209800
Predicted Effect probably damaging
Transcript: ENSMUST00000210135
AA Change: S845Y

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000210924
AA Change: S491Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000211145
AA Change: S825Y

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 28040521 missense probably damaging 0.98
IGL01862:Erc2 APN 14 28271569 splice site probably benign
IGL01906:Erc2 APN 14 28141306 missense probably damaging 0.99
IGL02177:Erc2 APN 14 27898623 missense probably benign 0.00
IGL02481:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02483:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02623:Erc2 APN 14 27776980 missense probably damaging 1.00
IGL03252:Erc2 APN 14 28475649 utr 3 prime probably benign
IGL03378:Erc2 APN 14 28011723 missense probably damaging 1.00
lobe UTSW 14 28317251 missense probably damaging 0.96
R0091:Erc2 UTSW 14 27776824 critical splice acceptor site probably null
R0309:Erc2 UTSW 14 28141225 missense probably damaging 0.98
R0357:Erc2 UTSW 14 27777022 missense probably damaging 0.99
R0378:Erc2 UTSW 14 28011694 missense probably damaging 1.00
R0550:Erc2 UTSW 14 28271651 missense possibly damaging 0.74
R0815:Erc2 UTSW 14 28025148 missense probably benign 0.04
R0863:Erc2 UTSW 14 28025148 missense probably benign 0.04
R1121:Erc2 UTSW 14 28475655 utr 3 prime probably benign
R1164:Erc2 UTSW 14 28302972 missense probably damaging 0.99
R1498:Erc2 UTSW 14 28302898 missense probably benign 0.27
R1500:Erc2 UTSW 14 28271660 missense probably damaging 0.98
R1555:Erc2 UTSW 14 28011665 missense probably damaging 0.99
R1894:Erc2 UTSW 14 28141228 missense probably damaging 0.99
R1950:Erc2 UTSW 14 27912900 missense probably damaging 0.99
R1991:Erc2 UTSW 14 28011636 missense probably benign 0.34
R2698:Erc2 UTSW 14 28271705 missense probably benign 0.06
R2847:Erc2 UTSW 14 28040488 missense probably damaging 0.97
R3015:Erc2 UTSW 14 28011775 critical splice donor site probably null
R3612:Erc2 UTSW 14 27777177 missense possibly damaging 0.69
R3759:Erc2 UTSW 14 28025163 missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3858:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3859:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R4556:Erc2 UTSW 14 28302904 missense probably damaging 1.00
R4739:Erc2 UTSW 14 27776881 missense probably damaging 1.00
R4898:Erc2 UTSW 14 27653328 missense probably damaging 1.00
R5068:Erc2 UTSW 14 28302943 missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27652872 missense probably benign 0.40
R5418:Erc2 UTSW 14 27966510 missense probably benign 0.14
R5741:Erc2 UTSW 14 28302869 splice site probably null
R5819:Erc2 UTSW 14 28141369 missense probably damaging 0.97
R5930:Erc2 UTSW 14 27776858 missense probably damaging 0.99
R6073:Erc2 UTSW 14 28011636 missense probably benign 0.00
R6182:Erc2 UTSW 14 28317253 missense probably damaging 0.99
R6188:Erc2 UTSW 14 28317251 missense probably damaging 0.96
R6267:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6296:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6730:Erc2 UTSW 14 27898567 missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27898596 missense probably damaging 1.00
R7095:Erc2 UTSW 14 27898593 missense probably damaging 0.99
R7221:Erc2 UTSW 14 27653158 missense probably damaging 0.97
R7365:Erc2 UTSW 14 28040389 missense probably damaging 1.00
R7454:Erc2 UTSW 14 28302991 missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27876204 critical splice donor site probably null
R7784:Erc2 UTSW 14 27898594 missense probably damaging 0.96
R7890:Erc2 UTSW 14 28040341 critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27777208 missense probably damaging 1.00
R7973:Erc2 UTSW 14 28040341 critical splice acceptor site probably null
R7977:Erc2 UTSW 14 27777208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCAGATGTCGCGTTGTC -3'
(R):5'- GGCTGTACAGTCTCAATGGG -3'

Sequencing Primer
(F):5'- CCCTCTGTGTCTCTCAGAACAAGATG -3'
(R):5'- GTGCACAAGGGGTAGCC -3'
Posted On2017-10-10