Incidental Mutation 'R6150:Zfp521'
ID489216
Institutional Source Beutler Lab
Gene Symbol Zfp521
Ensembl Gene ENSMUSG00000024420
Gene Namezinc finger protein 521
SynonymsB930086A16Rik, Evi3
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location13687013-13972733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13844078 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1093 (C1093S)
Ref Sequence ENSEMBL: ENSMUSP00000025288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025288]
Predicted Effect probably damaging
Transcript: ENSMUST00000025288
AA Change: C1093S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025288
Gene: ENSMUSG00000024420
AA Change: C1093S

DomainStartEndE-ValueType
ZnF_C2H2 47 68 3.47e1 SMART
low complexity region 82 100 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
ZnF_C2H2 118 140 3.89e-3 SMART
ZnF_C2H2 146 168 1.33e-1 SMART
ZnF_C2H2 174 196 1.38e-3 SMART
ZnF_C2H2 202 224 2.36e-2 SMART
ZnF_C2H2 246 269 6.57e-1 SMART
ZnF_C2H2 281 304 3.52e-1 SMART
ZnF_C2H2 310 332 1.76e-1 SMART
low complexity region 345 358 N/A INTRINSIC
ZnF_C2H2 405 429 4.34e-1 SMART
ZnF_C2H2 437 460 6.23e-2 SMART
ZnF_C2H2 477 500 8.94e-3 SMART
ZnF_C2H2 513 536 5.42e-2 SMART
ZnF_C2H2 560 585 1.86e0 SMART
ZnF_C2H2 634 656 1.12e-3 SMART
ZnF_C2H2 664 686 2.12e-4 SMART
ZnF_C2H2 694 717 6.42e-4 SMART
ZnF_C2H2 722 745 7.78e-3 SMART
ZnF_C2H2 752 775 6.32e-3 SMART
ZnF_C2H2 783 805 2.05e-2 SMART
ZnF_C2H2 809 832 4.72e-2 SMART
ZnF_C2H2 886 909 1.86e0 SMART
ZnF_C2H2 930 952 3.04e-5 SMART
ZnF_C2H2 959 981 6.42e-4 SMART
ZnF_C2H2 988 1010 7.49e0 SMART
ZnF_C2H2 1020 1042 4.99e1 SMART
Blast:RING 1067 1098 1e-9 BLAST
low complexity region 1099 1119 N/A INTRINSIC
ZnF_C2H2 1138 1161 1.79e-2 SMART
ZnF_C2H2 1195 1217 2.53e-2 SMART
ZnF_C2H2 1225 1247 2.32e-1 SMART
ZnF_C2H2 1256 1279 2.91e-2 SMART
ZnF_C2H2 1286 1309 5.72e-1 SMART
Meta Mutation Damage Score 0.4840 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit postnatal growth retardation, behavioral anomalies including hyperlocomotion, lower anxiety, higher impulsivity and impaired learning, abnormal formation of the neuronal cell layers of the dentate gyrus in the hippocampus, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Zfp521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Zfp521 APN 18 13846502 missense probably benign 0.15
IGL00499:Zfp521 APN 18 13939120 missense probably benign 0.25
IGL01291:Zfp521 APN 18 13817246 missense probably damaging 1.00
IGL01335:Zfp521 APN 18 13844719 missense probably benign 0.31
IGL01384:Zfp521 APN 18 13843923 missense probably benign 0.26
IGL01520:Zfp521 APN 18 13938988 missense possibly damaging 0.92
IGL02248:Zfp521 APN 18 13844246 missense possibly damaging 0.93
IGL02640:Zfp521 APN 18 13844930 missense probably benign 0.00
ANU05:Zfp521 UTSW 18 13817246 missense probably damaging 1.00
R0113:Zfp521 UTSW 18 13845091 missense probably damaging 1.00
R0197:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R0457:Zfp521 UTSW 18 13844840 missense probably benign
R0494:Zfp521 UTSW 18 13845268 missense probably damaging 1.00
R0494:Zfp521 UTSW 18 13846870 missense probably damaging 1.00
R0883:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R2133:Zfp521 UTSW 18 13844705 missense possibly damaging 0.88
R2263:Zfp521 UTSW 18 13846240 missense possibly damaging 0.89
R3699:Zfp521 UTSW 18 13846273 nonsense probably null
R3760:Zfp521 UTSW 18 13844629 missense possibly damaging 0.93
R3851:Zfp521 UTSW 18 13717751 splice site probably benign
R3950:Zfp521 UTSW 18 13846346 missense probably damaging 0.99
R4398:Zfp521 UTSW 18 13846544 missense probably benign 0.26
R4583:Zfp521 UTSW 18 13844330 missense probably benign 0.19
R4688:Zfp521 UTSW 18 13844590 missense probably damaging 1.00
R4688:Zfp521 UTSW 18 13844591 nonsense probably null
R4698:Zfp521 UTSW 18 13845603 missense probably damaging 0.96
R4738:Zfp521 UTSW 18 13844054 missense possibly damaging 0.50
R5031:Zfp521 UTSW 18 13844273 missense possibly damaging 0.68
R5137:Zfp521 UTSW 18 13845448 missense probably damaging 1.00
R5257:Zfp521 UTSW 18 13846978 missense probably damaging 1.00
R5420:Zfp521 UTSW 18 13844087 missense probably damaging 1.00
R5917:Zfp521 UTSW 18 13845555 missense probably damaging 0.98
R5995:Zfp521 UTSW 18 13717624 missense probably damaging 1.00
R6088:Zfp521 UTSW 18 13846109 missense possibly damaging 0.47
R6261:Zfp521 UTSW 18 13844627 missense probably damaging 1.00
R7649:Zfp521 UTSW 18 13844356 missense probably damaging 1.00
R7662:Zfp521 UTSW 18 13844116 missense probably damaging 1.00
R7774:Zfp521 UTSW 18 13845781 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACACTTGGGGCGTTTTCAAC -3'
(R):5'- TGGAACTCAAAATCCACGGG -3'

Sequencing Primer
(F):5'- GCAGTTCGCTTTCAGACTCAAAC -3'
(R):5'- GGGACCTTCCACATGCAGAAG -3'
Posted On2017-10-10