Incidental Mutation 'R6151:Eprs'
ID489222
Institutional Source Beutler Lab
Gene Symbol Eprs
Ensembl Gene ENSMUSG00000026615
Gene Nameglutamyl-prolyl-tRNA synthetase
Synonyms2410081F06Rik, 3010002K18Rik, Qprs
MMRRC Submission 044298-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6151 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location185363044-185428360 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 185407754 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046514]
Predicted Effect probably null
Transcript: ENSMUST00000046514
SMART Domains Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615

DomainStartEndE-ValueType
Pfam:GST_C_3 71 156 2.1e-15 PFAM
Pfam:GST_C 72 157 2.9e-7 PFAM
Pfam:tRNA-synt_1c 197 502 8.8e-127 PFAM
Pfam:tRNA-synt_1c_C 504 681 4.4e-42 PFAM
WHEP-TRS 753 815 1.26e-25 SMART
WHEP-TRS 826 888 1.47e-26 SMART
WHEP-TRS 904 966 3.76e-24 SMART
low complexity region 984 1011 N/A INTRINSIC
Pfam:tRNA-synt_2b 1107 1287 3.1e-17 PFAM
Pfam:HGTP_anticodon 1303 1404 1.7e-19 PFAM
ProRS-C_1 1430 1512 5.27e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192284
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Eprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Eprs APN 1 185407148 missense probably benign 0.11
IGL00532:Eprs APN 1 185407148 missense probably benign 0.11
IGL00543:Eprs APN 1 185407148 missense probably benign 0.11
IGL00553:Eprs APN 1 185407148 missense probably benign 0.11
IGL00574:Eprs APN 1 185407148 missense probably benign 0.11
IGL00583:Eprs APN 1 185407148 missense probably benign 0.11
IGL00946:Eprs APN 1 185407701 missense probably benign 0.02
IGL01062:Eprs APN 1 185379615 missense probably benign 0.19
IGL01477:Eprs APN 1 185411375 splice site probably benign
IGL01608:Eprs APN 1 185385114 unclassified probably benign
IGL01767:Eprs APN 1 185384915 missense probably damaging 0.98
IGL02136:Eprs APN 1 185384983 missense probably damaging 1.00
IGL02302:Eprs APN 1 185387124 splice site probably benign
IGL02528:Eprs APN 1 185413489 missense probably damaging 1.00
IGL02631:Eprs APN 1 185427898 missense probably damaging 1.00
IGL02989:Eprs APN 1 185418366 missense probably benign 0.31
IGL03004:Eprs APN 1 185381833 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0179:Eprs UTSW 1 185413547 missense probably benign
R0783:Eprs UTSW 1 185398458 missense probably damaging 1.00
R1319:Eprs UTSW 1 185384962 missense probably damaging 1.00
R1335:Eprs UTSW 1 185387089 missense probably damaging 1.00
R1514:Eprs UTSW 1 185381834 missense probably damaging 0.99
R1590:Eprs UTSW 1 185401510 missense probably damaging 1.00
R1688:Eprs UTSW 1 185384896 missense probably damaging 0.99
R1725:Eprs UTSW 1 185406992 missense probably damaging 1.00
R2182:Eprs UTSW 1 185379742 splice site probably null
R2228:Eprs UTSW 1 185367537 missense probably damaging 1.00
R2336:Eprs UTSW 1 185411374 splice site probably benign
R2338:Eprs UTSW 1 185415808 missense probably damaging 1.00
R2439:Eprs UTSW 1 185379742 splice site probably null
R2914:Eprs UTSW 1 185379742 splice site probably null
R3001:Eprs UTSW 1 185424391 critical splice donor site probably null
R3002:Eprs UTSW 1 185424391 critical splice donor site probably null
R3003:Eprs UTSW 1 185424391 critical splice donor site probably null
R3547:Eprs UTSW 1 185379742 splice site probably null
R3775:Eprs UTSW 1 185373008 missense probably damaging 1.00
R3878:Eprs UTSW 1 185415953 critical splice donor site probably null
R3902:Eprs UTSW 1 185379742 splice site probably null
R3913:Eprs UTSW 1 185379742 splice site probably null
R4579:Eprs UTSW 1 185401607 missense probably damaging 1.00
R4664:Eprs UTSW 1 185373076 intron probably benign
R4680:Eprs UTSW 1 185386278 missense possibly damaging 0.87
R4712:Eprs UTSW 1 185428108 missense probably benign 0.00
R4749:Eprs UTSW 1 185396130 missense probably damaging 0.97
R4995:Eprs UTSW 1 185410139 intron probably benign
R5154:Eprs UTSW 1 185413465 missense probably damaging 1.00
R5640:Eprs UTSW 1 185374184 missense probably benign 0.34
R5662:Eprs UTSW 1 185394425 missense possibly damaging 0.72
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6387:Eprs UTSW 1 185387084 missense possibly damaging 0.94
R6647:Eprs UTSW 1 185414424 missense probably damaging 1.00
R6701:Eprs UTSW 1 185370890 missense probably damaging 0.99
R6997:Eprs UTSW 1 185396163 missense possibly damaging 0.50
R7295:Eprs UTSW 1 185418210 critical splice acceptor site probably null
R7305:Eprs UTSW 1 185379701 missense probably damaging 1.00
R7729:Eprs UTSW 1 185413169 missense probably damaging 1.00
R7732:Eprs UTSW 1 185372939 missense probably benign 0.01
R7733:Eprs UTSW 1 185397161 missense probably benign
R7826:Eprs UTSW 1 185406968 missense probably damaging 0.96
R7988:Eprs UTSW 1 185418348 missense probably damaging 1.00
R8071:Eprs UTSW 1 185394456 missense possibly damaging 0.67
R8157:Eprs UTSW 1 185398394 missense probably benign 0.21
R8209:Eprs UTSW 1 185407615 missense possibly damaging 0.71
R8370:Eprs UTSW 1 185399257 missense probably damaging 0.98
R8493:Eprs UTSW 1 185407174 nonsense probably null
R8556:Eprs UTSW 1 185420288 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGAAGGCACAGTACAAGTC -3'
(R):5'- TCTAAGTCTAAGGTGAGCAGGTG -3'

Sequencing Primer
(F):5'- ATCGAGTATAAGCCTGTGTCTGCTAC -3'
(R):5'- GTGATGTGCTGCCTATTTTTAACATC -3'
Posted On2017-10-10