Incidental Mutation 'R6151:Etl4'
ID 489224
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Name enhancer trap locus 4
Synonyms 6620402G01Rik, Sickle tail, E330027G05Rik, Etl-4, Skt, 9430077C05Rik
MMRRC Submission 044298-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.809) question?
Stock # R6151 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 19915018-20815346 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20718171 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 304 (I304N)
Ref Sequence ENSEMBL: ENSMUSP00000110274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627]
AlphaFold A2AQ25
Predicted Effect probably damaging
Transcript: ENSMUST00000045555
AA Change: I253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: I253N

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066509
AA Change: I253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: I253N

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114604
AA Change: I253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: I253N

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114610
AA Change: I173N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617
AA Change: I173N

DomainStartEndE-ValueType
Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: I253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: I253N

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114627
AA Change: I304N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: I304N

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146613
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,099,216 (GRCm39) probably null Het
4930550C14Rik G T 9: 53,325,683 (GRCm39) R73S probably damaging Het
Abca1 A G 4: 53,085,261 (GRCm39) V517A probably benign Het
Adck5 A T 15: 76,478,887 (GRCm39) K370N possibly damaging Het
Akap6 A C 12: 53,072,575 (GRCm39) D981A probably damaging Het
Apbb1 G A 7: 105,223,459 (GRCm39) R51* probably null Het
Arhgap23 A G 11: 97,391,238 (GRCm39) M1252V probably benign Het
Arhgef1 A G 7: 24,617,367 (GRCm39) T354A probably benign Het
Arid1a G T 4: 133,412,287 (GRCm39) Q1636K unknown Het
Asmt C T X: 169,110,202 (GRCm39) A237V possibly damaging Het
Brat1 T A 5: 140,691,716 (GRCm39) C43S probably benign Het
Cd36 T C 5: 18,000,593 (GRCm39) Y370C probably damaging Het
Ceacam12 A T 7: 17,803,030 (GRCm39) L145F probably benign Het
Col24a1 C T 3: 145,019,815 (GRCm39) T62I probably damaging Het
Col6a3 G T 1: 90,741,475 (GRCm39) N652K possibly damaging Het
Dcbld1 T C 10: 52,180,756 (GRCm39) L140P probably damaging Het
Dhrs13 G A 11: 77,927,808 (GRCm39) C218Y probably damaging Het
Diaph1 T G 18: 37,986,406 (GRCm39) E1158A probably damaging Het
Emp2 A C 16: 10,110,145 (GRCm39) F20C probably damaging Het
Enpep T C 3: 129,126,067 (GRCm39) I22V possibly damaging Het
Epha2 A G 4: 141,045,791 (GRCm39) probably null Het
Eprs1 G T 1: 185,139,951 (GRCm39) probably null Het
Exoc3l2 C A 7: 19,225,670 (GRCm39) S89* probably null Het
F5 G A 1: 164,017,756 (GRCm39) C611Y probably damaging Het
F5 A T 1: 164,009,204 (GRCm39) I325F probably damaging Het
Fam133b A T 5: 3,609,133 (GRCm39) S116C probably null Het
Fam13b A T 18: 34,627,330 (GRCm39) D190E probably damaging Het
Fam169a T G 13: 97,230,138 (GRCm39) Y58D probably damaging Het
Far1 G A 7: 113,160,603 (GRCm39) R383H possibly damaging Het
Fnbp1l T C 3: 122,364,579 (GRCm39) K52R possibly damaging Het
Foxj3 C A 4: 119,480,468 (GRCm39) Q469K unknown Het
Frs3 A T 17: 48,000,013 (GRCm39) probably benign Het
Gdpd3 A G 7: 126,374,674 (GRCm39) S290G probably benign Het
Gmip T A 8: 70,269,735 (GRCm39) L610Q probably damaging Het
Gprc5c T A 11: 114,754,851 (GRCm39) I176N probably damaging Het
Grm3 A G 5: 9,561,556 (GRCm39) F765L probably damaging Het
Hhat A T 1: 192,442,065 (GRCm39) L2Q probably damaging Het
Hspbap1 T C 16: 35,637,592 (GRCm39) S214P probably damaging Het
Ighv1-62-3 C A 12: 115,424,909 (GRCm39) V21F probably damaging Het
Kcnj15 A T 16: 95,096,527 (GRCm39) K50* probably null Het
Kidins220 T C 12: 25,106,908 (GRCm39) S1454P possibly damaging Het
Kl T A 5: 150,912,318 (GRCm39) M689K possibly damaging Het
Klhl23 T G 2: 69,655,198 (GRCm39) L356R probably damaging Het
Kndc1 A T 7: 139,501,129 (GRCm39) D806V probably benign Het
Krt26 T C 11: 99,228,315 (GRCm39) E139G probably benign Het
Lefty1 T C 1: 180,762,681 (GRCm39) F3L unknown Het
Madd A C 2: 90,995,802 (GRCm39) Y853* probably null Het
Map1a T A 2: 121,120,304 (GRCm39) D63E probably benign Het
Mdn1 T A 4: 32,684,735 (GRCm39) V815E probably damaging Het
Mettl3 A G 14: 52,532,477 (GRCm39) Y569H probably damaging Het
Mknk2 T C 10: 80,504,859 (GRCm39) probably null Het
Mpp3 C A 11: 101,899,392 (GRCm39) R376S probably benign Het
Ncoa4-ps T G 12: 119,224,841 (GRCm39) noncoding transcript Het
Nup160 T A 2: 90,520,449 (GRCm39) Y293* probably null Het
Nup58 A T 14: 60,482,065 (GRCm39) F100I possibly damaging Het
Nxpe2 A C 9: 48,237,491 (GRCm39) L255V probably benign Het
Or10ab4 A G 7: 107,655,106 (GRCm39) I306V probably benign Het
Or1e30 T A 11: 73,678,521 (GRCm39) Y252* probably null Het
Or2l5 A T 16: 19,334,281 (GRCm39) L35Q probably damaging Het
Or4d11 T C 19: 12,014,100 (GRCm39) E2G probably benign Het
Padi3 A T 4: 140,523,705 (GRCm39) D248E probably damaging Het
Paxip1 G T 5: 27,966,616 (GRCm39) H637N probably damaging Het
Pde4b T A 4: 102,458,748 (GRCm39) M296K probably damaging Het
Pkd1 A G 17: 24,794,580 (GRCm39) H2089R probably benign Het
Plaat5 C T 19: 7,596,656 (GRCm39) P148S probably damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Rhebl1 T C 15: 98,776,160 (GRCm39) I165V probably benign Het
Rock1 A T 18: 10,106,426 (GRCm39) V481E possibly damaging Het
Rtca T A 3: 116,301,476 (GRCm39) T24S probably benign Het
Serpina3c T A 12: 104,118,327 (GRCm39) I4F possibly damaging Het
Serpina3j C A 12: 104,283,649 (GRCm39) A249E possibly damaging Het
Slc38a9 A G 13: 112,825,910 (GRCm39) N116S probably damaging Het
Slco2b1 C T 7: 99,339,770 (GRCm39) V58I possibly damaging Het
Slfn8 T A 11: 82,908,147 (GRCm39) Y132F probably damaging Het
Smg6 T G 11: 75,047,033 (GRCm39) I1242S probably damaging Het
Tap2 G T 17: 34,431,021 (GRCm39) V374L probably benign Het
Tbc1d10b G A 7: 126,807,168 (GRCm39) T123M probably damaging Het
Tenm2 A C 11: 35,899,610 (GRCm39) V2516G probably damaging Het
Tenm3 C T 8: 48,848,608 (GRCm39) R12Q probably damaging Het
Tmem130 T A 5: 144,674,661 (GRCm39) M355L probably benign Het
Tns4 C T 11: 98,966,376 (GRCm39) S433N probably benign Het
Traip G T 9: 107,847,818 (GRCm39) probably null Het
Trmo G A 4: 46,389,390 (GRCm39) R2C probably damaging Het
Ttn A T 2: 76,774,504 (GRCm39) I2134N probably damaging Het
Uba1y A G Y: 825,984 (GRCm39) D380G probably benign Het
Ube2t T A 1: 134,895,698 (GRCm39) probably null Het
Ugdh A T 5: 65,574,924 (GRCm39) Y367* probably null Het
Usp45 A C 4: 21,810,797 (GRCm39) D331A probably damaging Het
Vmn1r84 G T 7: 12,095,841 (GRCm39) T284K possibly damaging Het
Vmn1r91 T A 7: 19,835,360 (GRCm39) F93Y probably benign Het
Vmn2r77 T A 7: 86,450,878 (GRCm39) Y255N probably benign Het
Vmn2r96 A T 17: 18,804,221 (GRCm39) Q490H probably benign Het
Vwa2 A G 19: 56,891,897 (GRCm39) probably null Het
Vwf A G 6: 125,634,028 (GRCm39) K169E unknown Het
Zc3h7b G C 15: 81,662,911 (GRCm39) probably null Het
Zfp458 T A 13: 67,405,662 (GRCm39) H259L possibly damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp804b A G 5: 6,819,910 (GRCm39) V1051A probably benign Het
Zfp998 A T 13: 66,579,740 (GRCm39) C248S probably damaging Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20,771,289 (GRCm39) missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20,534,865 (GRCm39) missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20,811,342 (GRCm39) nonsense probably null
IGL01099:Etl4 APN 2 20,811,922 (GRCm39) missense probably benign 0.06
IGL01337:Etl4 APN 2 20,790,198 (GRCm39) missense probably benign 0.01
IGL01348:Etl4 APN 2 20,811,784 (GRCm39) missense probably damaging 1.00
IGL01349:Etl4 APN 2 20,718,207 (GRCm39) missense probably damaging 1.00
IGL01407:Etl4 APN 2 20,748,667 (GRCm39) missense probably damaging 0.99
IGL01552:Etl4 APN 2 20,783,000 (GRCm39) missense probably damaging 0.99
IGL01662:Etl4 APN 2 20,811,460 (GRCm39) missense probably benign 0.04
IGL01687:Etl4 APN 2 20,534,898 (GRCm39) missense probably damaging 1.00
IGL01793:Etl4 APN 2 20,748,709 (GRCm39) missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20,811,493 (GRCm39) missense probably benign 0.06
IGL02025:Etl4 APN 2 20,811,337 (GRCm39) missense probably damaging 1.00
IGL02088:Etl4 APN 2 20,811,359 (GRCm39) missense probably damaging 1.00
IGL02134:Etl4 APN 2 20,811,240 (GRCm39) missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20,535,000 (GRCm39) missense probably damaging 1.00
IGL02480:Etl4 APN 2 20,793,335 (GRCm39) missense probably damaging 0.99
IGL02560:Etl4 APN 2 20,748,529 (GRCm39) missense probably damaging 1.00
IGL02851:Etl4 APN 2 20,812,840 (GRCm39) missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20,765,021 (GRCm39) splice site probably benign
IGL02951:Etl4 APN 2 20,806,348 (GRCm39) splice site probably benign
IGL03119:Etl4 APN 2 20,718,198 (GRCm39) missense probably damaging 1.00
IGL03267:Etl4 APN 2 20,789,993 (GRCm39) nonsense probably null
IGL03379:Etl4 APN 2 20,666,827 (GRCm39) missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0038:Etl4 UTSW 2 20,748,385 (GRCm39) missense probably damaging 1.00
R0095:Etl4 UTSW 2 20,748,679 (GRCm39) missense probably damaging 1.00
R0100:Etl4 UTSW 2 20,344,716 (GRCm39) missense probably benign
R0311:Etl4 UTSW 2 20,811,940 (GRCm39) missense probably damaging 1.00
R0346:Etl4 UTSW 2 20,764,463 (GRCm39) critical splice donor site probably null
R0348:Etl4 UTSW 2 20,782,940 (GRCm39) missense probably damaging 1.00
R0379:Etl4 UTSW 2 20,812,165 (GRCm39) missense probably damaging 0.98
R0571:Etl4 UTSW 2 20,748,580 (GRCm39) missense probably damaging 0.99
R0697:Etl4 UTSW 2 20,748,672 (GRCm39) missense probably damaging 1.00
R0707:Etl4 UTSW 2 20,810,382 (GRCm39) splice site probably benign
R0980:Etl4 UTSW 2 20,806,378 (GRCm39) missense probably damaging 1.00
R1120:Etl4 UTSW 2 20,811,514 (GRCm39) missense probably benign 0.00
R1254:Etl4 UTSW 2 20,812,734 (GRCm39) missense probably damaging 1.00
R1346:Etl4 UTSW 2 20,810,955 (GRCm39) missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20,793,288 (GRCm39) missense probably damaging 1.00
R1503:Etl4 UTSW 2 20,748,685 (GRCm39) missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R1627:Etl4 UTSW 2 20,806,390 (GRCm39) missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20,811,219 (GRCm39) missense probably damaging 1.00
R1716:Etl4 UTSW 2 20,748,492 (GRCm39) missense probably damaging 1.00
R1795:Etl4 UTSW 2 20,812,837 (GRCm39) critical splice donor site probably null
R1885:Etl4 UTSW 2 20,748,795 (GRCm39) missense probably damaging 1.00
R2039:Etl4 UTSW 2 20,790,039 (GRCm39) missense probably damaging 1.00
R2083:Etl4 UTSW 2 20,748,360 (GRCm39) missense probably damaging 1.00
R2109:Etl4 UTSW 2 20,790,153 (GRCm39) missense probably benign 0.27
R2153:Etl4 UTSW 2 20,803,545 (GRCm39) missense probably benign 0.00
R2403:Etl4 UTSW 2 20,812,117 (GRCm39) nonsense probably null
R2883:Etl4 UTSW 2 20,810,985 (GRCm39) missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20,786,660 (GRCm39) missense probably damaging 1.00
R3402:Etl4 UTSW 2 20,786,693 (GRCm39) missense probably damaging 1.00
R3696:Etl4 UTSW 2 20,806,473 (GRCm39) critical splice donor site probably null
R3755:Etl4 UTSW 2 20,748,348 (GRCm39) missense probably benign 0.10
R3813:Etl4 UTSW 2 20,793,246 (GRCm39) missense probably damaging 1.00
R3829:Etl4 UTSW 2 20,790,232 (GRCm39) missense probably benign 0.07
R3887:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3888:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3889:Etl4 UTSW 2 20,534,772 (GRCm39) nonsense probably null
R3958:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3959:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R3960:Etl4 UTSW 2 20,344,854 (GRCm39) missense probably benign
R4058:Etl4 UTSW 2 20,810,830 (GRCm39) missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20,814,030 (GRCm39) utr 3 prime probably benign
R4077:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4078:Etl4 UTSW 2 20,812,772 (GRCm39) missense probably damaging 1.00
R4127:Etl4 UTSW 2 20,748,886 (GRCm39) missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20,786,694 (GRCm39) missense probably damaging 1.00
R4492:Etl4 UTSW 2 20,811,676 (GRCm39) missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20,666,709 (GRCm39) missense probably damaging 1.00
R4820:Etl4 UTSW 2 20,811,496 (GRCm39) missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20,811,738 (GRCm39) missense probably damaging 1.00
R4888:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R4938:Etl4 UTSW 2 20,803,460 (GRCm39) missense probably benign 0.00
R4943:Etl4 UTSW 2 20,812,092 (GRCm39) missense probably benign 0.05
R5121:Etl4 UTSW 2 20,344,922 (GRCm39) critical splice donor site probably null
R5191:Etl4 UTSW 2 20,344,810 (GRCm39) missense probably damaging 0.99
R5198:Etl4 UTSW 2 20,718,198 (GRCm39) missense probably damaging 1.00
R5199:Etl4 UTSW 2 20,748,853 (GRCm39) missense probably damaging 1.00
R5470:Etl4 UTSW 2 20,534,791 (GRCm39) missense probably damaging 0.99
R5513:Etl4 UTSW 2 20,748,638 (GRCm39) missense probably damaging 1.00
R5620:Etl4 UTSW 2 20,535,037 (GRCm39) missense probably damaging 1.00
R5635:Etl4 UTSW 2 20,811,846 (GRCm39) missense probably damaging 1.00
R5641:Etl4 UTSW 2 20,811,273 (GRCm39) frame shift probably null
R5690:Etl4 UTSW 2 20,810,647 (GRCm39) missense probably benign 0.01
R5784:Etl4 UTSW 2 20,811,016 (GRCm39) missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20,811,323 (GRCm39) missense probably damaging 1.00
R5908:Etl4 UTSW 2 20,748,718 (GRCm39) missense probably damaging 0.96
R5982:Etl4 UTSW 2 20,785,826 (GRCm39) missense probably damaging 1.00
R6192:Etl4 UTSW 2 20,806,362 (GRCm39) missense probably damaging 0.98
R6238:Etl4 UTSW 2 20,806,379 (GRCm39) missense probably damaging 1.00
R6248:Etl4 UTSW 2 20,813,900 (GRCm39) missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20,748,384 (GRCm39) missense probably damaging 1.00
R6610:Etl4 UTSW 2 20,718,180 (GRCm39) missense probably damaging 1.00
R6739:Etl4 UTSW 2 20,718,246 (GRCm39) missense probably damaging 1.00
R6846:Etl4 UTSW 2 20,748,919 (GRCm39) missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20,811,120 (GRCm39) missense probably benign 0.01
R6873:Etl4 UTSW 2 20,802,803 (GRCm39) splice site probably null
R7003:Etl4 UTSW 2 20,810,695 (GRCm39) missense probably benign 0.03
R7155:Etl4 UTSW 2 20,811,742 (GRCm39) missense probably damaging 0.96
R7207:Etl4 UTSW 2 20,714,387 (GRCm39) missense probably damaging 0.99
R7230:Etl4 UTSW 2 20,802,799 (GRCm39) missense probably damaging 1.00
R7305:Etl4 UTSW 2 20,714,368 (GRCm39) missense probably damaging 1.00
R7389:Etl4 UTSW 2 20,789,904 (GRCm39) nonsense probably null
R7396:Etl4 UTSW 2 20,803,449 (GRCm39) missense possibly damaging 0.62
R7441:Etl4 UTSW 2 20,749,000 (GRCm39) missense possibly damaging 0.87
R7626:Etl4 UTSW 2 20,718,189 (GRCm39) missense probably damaging 1.00
R7776:Etl4 UTSW 2 20,811,957 (GRCm39) missense probably damaging 0.99
R7779:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R7798:Etl4 UTSW 2 20,786,757 (GRCm39) critical splice donor site probably null
R7851:Etl4 UTSW 2 20,748,951 (GRCm39) missense probably damaging 1.00
R7861:Etl4 UTSW 2 20,810,721 (GRCm39) missense probably benign
R7901:Etl4 UTSW 2 20,294,821 (GRCm39) missense possibly damaging 0.83
R8053:Etl4 UTSW 2 20,666,774 (GRCm39) missense probably damaging 1.00
R8124:Etl4 UTSW 2 20,811,451 (GRCm39) missense probably benign 0.06
R8133:Etl4 UTSW 2 20,811,082 (GRCm39) missense possibly damaging 0.86
R8203:Etl4 UTSW 2 20,789,916 (GRCm39) missense possibly damaging 0.61
R8238:Etl4 UTSW 2 20,811,342 (GRCm39) nonsense probably null
R8263:Etl4 UTSW 2 20,748,965 (GRCm39) missense probably benign 0.00
R8299:Etl4 UTSW 2 20,748,874 (GRCm39) missense possibly damaging 0.81
R8318:Etl4 UTSW 2 20,793,341 (GRCm39) missense probably damaging 1.00
R8334:Etl4 UTSW 2 20,785,857 (GRCm39) missense probably damaging 0.96
R8443:Etl4 UTSW 2 20,810,977 (GRCm39) missense probably benign 0.04
R8525:Etl4 UTSW 2 20,534,892 (GRCm39) missense probably damaging 1.00
R8679:Etl4 UTSW 2 20,714,288 (GRCm39) missense probably damaging 1.00
R8918:Etl4 UTSW 2 20,811,246 (GRCm39) missense probably benign 0.00
R8918:Etl4 UTSW 2 20,748,733 (GRCm39) missense probably benign
R9062:Etl4 UTSW 2 20,748,616 (GRCm39) missense probably damaging 0.99
R9095:Etl4 UTSW 2 20,782,964 (GRCm39) missense probably damaging 1.00
R9200:Etl4 UTSW 2 20,786,702 (GRCm39) missense probably damaging 1.00
R9416:Etl4 UTSW 2 20,748,784 (GRCm39) missense probably benign 0.17
R9437:Etl4 UTSW 2 20,813,872 (GRCm39) missense probably benign 0.20
R9451:Etl4 UTSW 2 20,813,926 (GRCm39) missense probably benign 0.03
R9489:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9531:Etl4 UTSW 2 20,294,818 (GRCm39) start codon destroyed probably null 0.01
R9605:Etl4 UTSW 2 20,771,345 (GRCm39) missense possibly damaging 0.75
R9623:Etl4 UTSW 2 20,811,052 (GRCm39) missense
R9631:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9632:Etl4 UTSW 2 20,666,749 (GRCm39) missense probably benign 0.28
R9646:Etl4 UTSW 2 20,802,724 (GRCm39) missense probably benign 0.00
R9732:Etl4 UTSW 2 20,748,373 (GRCm39) missense probably damaging 0.98
R9755:Etl4 UTSW 2 20,790,048 (GRCm39) missense probably benign 0.17
R9771:Etl4 UTSW 2 20,811,537 (GRCm39) missense probably benign
RF003:Etl4 UTSW 2 20,524,729 (GRCm39) nonsense probably null
X0018:Etl4 UTSW 2 20,814,001 (GRCm39) missense probably damaging 0.98
X0022:Etl4 UTSW 2 20,714,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGAATAACATGTTCGCTAGG -3'
(R):5'- ATGAGCAGCATGAACCTGGG -3'

Sequencing Primer
(F):5'- TTCGCTAGGAACAAGTGAAGG -3'
(R):5'- GAACCATGGTCGTCAGGTATG -3'
Posted On 2017-10-10