Incidental Mutation 'R6151:Madd'
ID 489229
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene Name MAP-kinase activating death domain
Synonyms Rab3 GEP, 9630059K23Rik
MMRRC Submission 044298-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6151 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 90967705-91013404 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to C at 90995802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 853 (Y853*)
Ref Sequence ENSEMBL: ENSMUSP00000107012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381] [ENSMUST00000140600]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000066420
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066473
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075269
AA Change: Y834*
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: Y834*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077941
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099723
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099725
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111369
AA Change: Y810*
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: Y810*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111370
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111371
AA Change: Y834*
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: Y834*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111372
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111373
AA Change: Y810*
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: Y810*

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111375
AA Change: Y810*
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: Y810*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111376
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111381
AA Change: Y853*
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: Y853*

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125321
Predicted Effect probably benign
Transcript: ENSMUST00000140600
SMART Domains Protein: ENSMUSP00000117657
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
Blast:DENN 1 28 7e-10 BLAST
low complexity region 39 55 N/A INTRINSIC
dDENN 111 165 9.37e-1 SMART
low complexity region 230 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,099,216 (GRCm39) probably null Het
4930550C14Rik G T 9: 53,325,683 (GRCm39) R73S probably damaging Het
Abca1 A G 4: 53,085,261 (GRCm39) V517A probably benign Het
Adck5 A T 15: 76,478,887 (GRCm39) K370N possibly damaging Het
Akap6 A C 12: 53,072,575 (GRCm39) D981A probably damaging Het
Apbb1 G A 7: 105,223,459 (GRCm39) R51* probably null Het
Arhgap23 A G 11: 97,391,238 (GRCm39) M1252V probably benign Het
Arhgef1 A G 7: 24,617,367 (GRCm39) T354A probably benign Het
Arid1a G T 4: 133,412,287 (GRCm39) Q1636K unknown Het
Asmt C T X: 169,110,202 (GRCm39) A237V possibly damaging Het
Brat1 T A 5: 140,691,716 (GRCm39) C43S probably benign Het
Cd36 T C 5: 18,000,593 (GRCm39) Y370C probably damaging Het
Ceacam12 A T 7: 17,803,030 (GRCm39) L145F probably benign Het
Col24a1 C T 3: 145,019,815 (GRCm39) T62I probably damaging Het
Col6a3 G T 1: 90,741,475 (GRCm39) N652K possibly damaging Het
Dcbld1 T C 10: 52,180,756 (GRCm39) L140P probably damaging Het
Dhrs13 G A 11: 77,927,808 (GRCm39) C218Y probably damaging Het
Diaph1 T G 18: 37,986,406 (GRCm39) E1158A probably damaging Het
Emp2 A C 16: 10,110,145 (GRCm39) F20C probably damaging Het
Enpep T C 3: 129,126,067 (GRCm39) I22V possibly damaging Het
Epha2 A G 4: 141,045,791 (GRCm39) probably null Het
Eprs1 G T 1: 185,139,951 (GRCm39) probably null Het
Etl4 T A 2: 20,718,171 (GRCm39) I304N probably damaging Het
Exoc3l2 C A 7: 19,225,670 (GRCm39) S89* probably null Het
F5 A T 1: 164,009,204 (GRCm39) I325F probably damaging Het
F5 G A 1: 164,017,756 (GRCm39) C611Y probably damaging Het
Fam133b A T 5: 3,609,133 (GRCm39) S116C probably null Het
Fam13b A T 18: 34,627,330 (GRCm39) D190E probably damaging Het
Fam169a T G 13: 97,230,138 (GRCm39) Y58D probably damaging Het
Far1 G A 7: 113,160,603 (GRCm39) R383H possibly damaging Het
Fnbp1l T C 3: 122,364,579 (GRCm39) K52R possibly damaging Het
Foxj3 C A 4: 119,480,468 (GRCm39) Q469K unknown Het
Frs3 A T 17: 48,000,013 (GRCm39) probably benign Het
Gdpd3 A G 7: 126,374,674 (GRCm39) S290G probably benign Het
Gmip T A 8: 70,269,735 (GRCm39) L610Q probably damaging Het
Gprc5c T A 11: 114,754,851 (GRCm39) I176N probably damaging Het
Grm3 A G 5: 9,561,556 (GRCm39) F765L probably damaging Het
Hhat A T 1: 192,442,065 (GRCm39) L2Q probably damaging Het
Hspbap1 T C 16: 35,637,592 (GRCm39) S214P probably damaging Het
Ighv1-62-3 C A 12: 115,424,909 (GRCm39) V21F probably damaging Het
Kcnj15 A T 16: 95,096,527 (GRCm39) K50* probably null Het
Kidins220 T C 12: 25,106,908 (GRCm39) S1454P possibly damaging Het
Kl T A 5: 150,912,318 (GRCm39) M689K possibly damaging Het
Klhl23 T G 2: 69,655,198 (GRCm39) L356R probably damaging Het
Kndc1 A T 7: 139,501,129 (GRCm39) D806V probably benign Het
Krt26 T C 11: 99,228,315 (GRCm39) E139G probably benign Het
Lefty1 T C 1: 180,762,681 (GRCm39) F3L unknown Het
Map1a T A 2: 121,120,304 (GRCm39) D63E probably benign Het
Mdn1 T A 4: 32,684,735 (GRCm39) V815E probably damaging Het
Mettl3 A G 14: 52,532,477 (GRCm39) Y569H probably damaging Het
Mknk2 T C 10: 80,504,859 (GRCm39) probably null Het
Mpp3 C A 11: 101,899,392 (GRCm39) R376S probably benign Het
Ncoa4-ps T G 12: 119,224,841 (GRCm39) noncoding transcript Het
Nup160 T A 2: 90,520,449 (GRCm39) Y293* probably null Het
Nup58 A T 14: 60,482,065 (GRCm39) F100I possibly damaging Het
Nxpe2 A C 9: 48,237,491 (GRCm39) L255V probably benign Het
Or10ab4 A G 7: 107,655,106 (GRCm39) I306V probably benign Het
Or1e30 T A 11: 73,678,521 (GRCm39) Y252* probably null Het
Or2l5 A T 16: 19,334,281 (GRCm39) L35Q probably damaging Het
Or4d11 T C 19: 12,014,100 (GRCm39) E2G probably benign Het
Padi3 A T 4: 140,523,705 (GRCm39) D248E probably damaging Het
Paxip1 G T 5: 27,966,616 (GRCm39) H637N probably damaging Het
Pde4b T A 4: 102,458,748 (GRCm39) M296K probably damaging Het
Pkd1 A G 17: 24,794,580 (GRCm39) H2089R probably benign Het
Plaat5 C T 19: 7,596,656 (GRCm39) P148S probably damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Rhebl1 T C 15: 98,776,160 (GRCm39) I165V probably benign Het
Rock1 A T 18: 10,106,426 (GRCm39) V481E possibly damaging Het
Rtca T A 3: 116,301,476 (GRCm39) T24S probably benign Het
Serpina3c T A 12: 104,118,327 (GRCm39) I4F possibly damaging Het
Serpina3j C A 12: 104,283,649 (GRCm39) A249E possibly damaging Het
Slc38a9 A G 13: 112,825,910 (GRCm39) N116S probably damaging Het
Slco2b1 C T 7: 99,339,770 (GRCm39) V58I possibly damaging Het
Slfn8 T A 11: 82,908,147 (GRCm39) Y132F probably damaging Het
Smg6 T G 11: 75,047,033 (GRCm39) I1242S probably damaging Het
Tap2 G T 17: 34,431,021 (GRCm39) V374L probably benign Het
Tbc1d10b G A 7: 126,807,168 (GRCm39) T123M probably damaging Het
Tenm2 A C 11: 35,899,610 (GRCm39) V2516G probably damaging Het
Tenm3 C T 8: 48,848,608 (GRCm39) R12Q probably damaging Het
Tmem130 T A 5: 144,674,661 (GRCm39) M355L probably benign Het
Tns4 C T 11: 98,966,376 (GRCm39) S433N probably benign Het
Traip G T 9: 107,847,818 (GRCm39) probably null Het
Trmo G A 4: 46,389,390 (GRCm39) R2C probably damaging Het
Ttn A T 2: 76,774,504 (GRCm39) I2134N probably damaging Het
Uba1y A G Y: 825,984 (GRCm39) D380G probably benign Het
Ube2t T A 1: 134,895,698 (GRCm39) probably null Het
Ugdh A T 5: 65,574,924 (GRCm39) Y367* probably null Het
Usp45 A C 4: 21,810,797 (GRCm39) D331A probably damaging Het
Vmn1r84 G T 7: 12,095,841 (GRCm39) T284K possibly damaging Het
Vmn1r91 T A 7: 19,835,360 (GRCm39) F93Y probably benign Het
Vmn2r77 T A 7: 86,450,878 (GRCm39) Y255N probably benign Het
Vmn2r96 A T 17: 18,804,221 (GRCm39) Q490H probably benign Het
Vwa2 A G 19: 56,891,897 (GRCm39) probably null Het
Vwf A G 6: 125,634,028 (GRCm39) K169E unknown Het
Zc3h7b G C 15: 81,662,911 (GRCm39) probably null Het
Zfp458 T A 13: 67,405,662 (GRCm39) H259L possibly damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp804b A G 5: 6,819,910 (GRCm39) V1051A probably benign Het
Zfp998 A T 13: 66,579,740 (GRCm39) C248S probably damaging Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91,006,111 (GRCm39) unclassified probably benign
IGL00781:Madd APN 2 90,977,273 (GRCm39) missense probably benign 0.00
IGL00844:Madd APN 2 90,998,213 (GRCm39) missense probably damaging 1.00
IGL00942:Madd APN 2 91,000,923 (GRCm39) missense probably damaging 1.00
IGL01100:Madd APN 2 90,988,385 (GRCm39) missense probably damaging 1.00
IGL01116:Madd APN 2 90,984,888 (GRCm39) splice site probably benign
IGL01694:Madd APN 2 90,988,320 (GRCm39) splice site probably benign
IGL01982:Madd APN 2 91,006,052 (GRCm39) missense probably damaging 1.00
IGL02346:Madd APN 2 90,992,836 (GRCm39) missense probably damaging 0.97
IGL02354:Madd APN 2 90,992,543 (GRCm39) missense probably benign 0.17
IGL02361:Madd APN 2 90,992,543 (GRCm39) missense probably benign 0.17
IGL02481:Madd APN 2 91,008,381 (GRCm39) missense probably damaging 1.00
IGL02483:Madd APN 2 91,008,381 (GRCm39) missense probably damaging 1.00
IGL02948:Madd APN 2 90,973,172 (GRCm39) missense probably benign
IGL03338:Madd APN 2 90,992,507 (GRCm39) missense possibly damaging 0.48
BB005:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
BB015:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
R0026:Madd UTSW 2 91,006,053 (GRCm39) missense possibly damaging 0.88
R0026:Madd UTSW 2 91,006,053 (GRCm39) missense possibly damaging 0.88
R0027:Madd UTSW 2 90,982,894 (GRCm39) missense probably damaging 0.97
R0085:Madd UTSW 2 90,993,083 (GRCm39) missense probably benign 0.00
R0577:Madd UTSW 2 90,968,740 (GRCm39) missense possibly damaging 0.88
R0587:Madd UTSW 2 90,977,230 (GRCm39) missense probably damaging 1.00
R1112:Madd UTSW 2 90,973,944 (GRCm39) missense probably damaging 1.00
R1722:Madd UTSW 2 90,997,982 (GRCm39) missense probably benign
R1750:Madd UTSW 2 90,998,236 (GRCm39) missense probably damaging 0.98
R2061:Madd UTSW 2 90,991,831 (GRCm39) intron probably benign
R2112:Madd UTSW 2 91,007,321 (GRCm39) missense possibly damaging 0.89
R2114:Madd UTSW 2 90,994,367 (GRCm39) missense probably damaging 1.00
R2140:Madd UTSW 2 90,982,854 (GRCm39) missense possibly damaging 0.80
R2276:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2277:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2279:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2424:Madd UTSW 2 90,996,967 (GRCm39) missense probably damaging 1.00
R2904:Madd UTSW 2 91,006,017 (GRCm39) missense probably damaging 1.00
R3122:Madd UTSW 2 91,006,554 (GRCm39) missense probably damaging 1.00
R3836:Madd UTSW 2 90,984,988 (GRCm39) critical splice donor site probably null
R3979:Madd UTSW 2 91,007,173 (GRCm39) missense possibly damaging 0.81
R4151:Madd UTSW 2 90,973,428 (GRCm39) missense probably benign 0.11
R4233:Madd UTSW 2 91,008,581 (GRCm39) missense probably benign 0.26
R4236:Madd UTSW 2 90,997,373 (GRCm39) missense probably benign 0.00
R4299:Madd UTSW 2 91,000,148 (GRCm39) missense probably damaging 1.00
R4334:Madd UTSW 2 90,970,917 (GRCm39) missense probably benign 0.08
R4413:Madd UTSW 2 90,997,932 (GRCm39) missense probably damaging 1.00
R4595:Madd UTSW 2 90,998,009 (GRCm39) missense possibly damaging 0.80
R4694:Madd UTSW 2 90,990,673 (GRCm39) missense probably damaging 0.99
R5410:Madd UTSW 2 90,984,859 (GRCm39) missense probably damaging 1.00
R5490:Madd UTSW 2 91,000,980 (GRCm39) missense possibly damaging 0.80
R5560:Madd UTSW 2 90,993,890 (GRCm39) missense probably damaging 1.00
R5661:Madd UTSW 2 90,984,778 (GRCm39) critical splice donor site probably null
R5710:Madd UTSW 2 90,984,821 (GRCm39) missense probably damaging 1.00
R5730:Madd UTSW 2 90,988,454 (GRCm39) missense probably damaging 1.00
R5759:Madd UTSW 2 90,992,420 (GRCm39) missense possibly damaging 0.94
R5768:Madd UTSW 2 90,998,174 (GRCm39) missense probably damaging 1.00
R5822:Madd UTSW 2 90,982,878 (GRCm39) missense probably damaging 1.00
R6125:Madd UTSW 2 90,982,797 (GRCm39) critical splice donor site probably null
R6229:Madd UTSW 2 90,974,015 (GRCm39) missense probably damaging 0.96
R6230:Madd UTSW 2 90,973,866 (GRCm39) critical splice donor site probably null
R6245:Madd UTSW 2 91,008,449 (GRCm39) missense probably benign 0.27
R6323:Madd UTSW 2 90,991,783 (GRCm39) splice site probably null
R6456:Madd UTSW 2 91,008,536 (GRCm39) missense probably benign
R6473:Madd UTSW 2 90,997,404 (GRCm39) missense probably benign
R6878:Madd UTSW 2 91,000,202 (GRCm39) missense probably damaging 1.00
R7060:Madd UTSW 2 91,007,452 (GRCm39) missense probably damaging 1.00
R7065:Madd UTSW 2 90,985,402 (GRCm39) missense probably benign 0.26
R7073:Madd UTSW 2 90,992,854 (GRCm39) missense probably damaging 1.00
R7124:Madd UTSW 2 90,992,393 (GRCm39) missense possibly damaging 0.94
R7251:Madd UTSW 2 90,992,521 (GRCm39) missense probably benign 0.01
R7510:Madd UTSW 2 91,008,321 (GRCm39) missense possibly damaging 0.80
R7605:Madd UTSW 2 91,000,055 (GRCm39) missense possibly damaging 0.90
R7911:Madd UTSW 2 90,997,853 (GRCm39) missense probably null 0.01
R7928:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
R7952:Madd UTSW 2 90,992,886 (GRCm39) missense probably damaging 1.00
R8039:Madd UTSW 2 90,997,406 (GRCm39) missense probably benign 0.17
R8047:Madd UTSW 2 91,009,546 (GRCm39) missense probably damaging 1.00
R8048:Madd UTSW 2 90,984,793 (GRCm39) missense probably damaging 0.99
R8070:Madd UTSW 2 90,988,359 (GRCm39) nonsense probably null
R8090:Madd UTSW 2 90,985,968 (GRCm39) missense probably benign 0.01
R8335:Madd UTSW 2 91,000,584 (GRCm39) missense probably damaging 1.00
R8459:Madd UTSW 2 90,992,871 (GRCm39) missense probably benign
R8678:Madd UTSW 2 91,006,610 (GRCm39) missense probably damaging 1.00
R8920:Madd UTSW 2 91,007,168 (GRCm39) missense probably benign 0.04
R9003:Madd UTSW 2 90,988,359 (GRCm39) nonsense probably null
R9102:Madd UTSW 2 90,988,404 (GRCm39) missense probably benign 0.00
R9154:Madd UTSW 2 90,998,162 (GRCm39) missense probably damaging 1.00
R9242:Madd UTSW 2 90,973,949 (GRCm39) missense probably damaging 0.99
R9277:Madd UTSW 2 91,006,055 (GRCm39) missense probably damaging 1.00
R9394:Madd UTSW 2 91,000,199 (GRCm39) missense probably benign
R9490:Madd UTSW 2 91,008,501 (GRCm39) missense probably benign
R9499:Madd UTSW 2 91,000,434 (GRCm39) missense probably damaging 1.00
R9551:Madd UTSW 2 91,000,434 (GRCm39) missense probably damaging 1.00
R9553:Madd UTSW 2 91,008,800 (GRCm39) missense probably damaging 1.00
R9599:Madd UTSW 2 91,006,026 (GRCm39) missense probably damaging 1.00
R9695:Madd UTSW 2 90,992,929 (GRCm39) missense probably benign 0.17
R9729:Madd UTSW 2 91,000,544 (GRCm39) missense possibly damaging 0.60
X0067:Madd UTSW 2 90,982,818 (GRCm39) missense probably damaging 1.00
Z1176:Madd UTSW 2 90,989,617 (GRCm39) missense probably damaging 0.96
Z1177:Madd UTSW 2 90,973,176 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAATGATTCATGGTGCGC -3'
(R):5'- ACGCAGCCTGAGAAAACTAG -3'

Sequencing Primer
(F):5'- ATTCATGGTGCGCAGGCTC -3'
(R):5'- CCTGAGAAAACTAGGACTGCATTTTG -3'
Posted On 2017-10-10