Incidental Mutation 'R6151:Map1a'
ID 489230
Institutional Source Beutler Lab
Gene Symbol Map1a
Ensembl Gene ENSMUSG00000027254
Gene Name microtubule-associated protein 1 A
Synonyms Mtap1, Mtap-1, 6330416M19Rik, Mtap1a
MMRRC Submission 044298-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.347) question?
Stock # R6151 (G1)
Quality Score 158.009
Status Not validated
Chromosome 2
Chromosomal Location 121289600-121310832 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121289823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 63 (D63E)
Ref Sequence ENSEMBL: ENSMUSP00000092223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094639]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094639
AA Change: D63E

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: D63E

DomainStartEndE-ValueType
Blast:Lactamase_B 286 538 2e-54 BLAST
SCOP:d1eq1a_ 584 699 8e-5 SMART
low complexity region 743 755 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
low complexity region 852 867 N/A INTRINSIC
low complexity region 897 911 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1334 1344 N/A INTRINSIC
low complexity region 1540 1555 N/A INTRINSIC
coiled coil region 1573 1602 N/A INTRINSIC
internal_repeat_1 1616 1726 7.66e-6 PROSPERO
coiled coil region 1747 1771 N/A INTRINSIC
internal_repeat_1 1774 1888 7.66e-6 PROSPERO
low complexity region 2060 2084 N/A INTRINSIC
low complexity region 2121 2133 N/A INTRINSIC
low complexity region 2156 2169 N/A INTRINSIC
low complexity region 2383 2396 N/A INTRINSIC
low complexity region 2436 2460 N/A INTRINSIC
low complexity region 2517 2541 N/A INTRINSIC
low complexity region 2589 2600 N/A INTRINSIC
low complexity region 2662 2682 N/A INTRINSIC
low complexity region 2685 2704 N/A INTRINSIC
low complexity region 2716 2728 N/A INTRINSIC
low complexity region 2766 2790 N/A INTRINSIC
low complexity region 2980 2988 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131901
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Map1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Map1a APN 2 121299027 missense probably damaging 0.99
IGL00826:Map1a APN 2 121302276 missense possibly damaging 0.87
IGL01476:Map1a APN 2 121305207 missense probably damaging 1.00
IGL02029:Map1a APN 2 121303298 missense possibly damaging 0.57
IGL02100:Map1a APN 2 121302846 missense probably damaging 0.99
IGL02136:Map1a APN 2 121300212 missense probably damaging 1.00
IGL02146:Map1a APN 2 121299446 missense probably damaging 1.00
IGL02264:Map1a APN 2 121307313 missense probably damaging 1.00
IGL02456:Map1a APN 2 121298653 missense probably damaging 1.00
IGL02485:Map1a APN 2 121299288 missense probably damaging 1.00
IGL02535:Map1a APN 2 121302177 nonsense probably null
IGL02628:Map1a APN 2 121300104 missense probably damaging 1.00
IGL02721:Map1a APN 2 121304037 missense probably benign 0.44
IGL03273:Map1a APN 2 121300238 missense probably damaging 1.00
IGL03281:Map1a APN 2 121305060 missense probably damaging 1.00
IGL02991:Map1a UTSW 2 121301610 missense probably damaging 0.99
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0218:Map1a UTSW 2 121305425 missense probably benign 0.00
R0363:Map1a UTSW 2 121302044 missense probably damaging 1.00
R0450:Map1a UTSW 2 121305774 missense probably benign 0.27
R0469:Map1a UTSW 2 121305774 missense probably benign 0.27
R0477:Map1a UTSW 2 121302101 missense probably damaging 1.00
R0504:Map1a UTSW 2 121302941 missense probably benign 0.03
R0510:Map1a UTSW 2 121305774 missense probably benign 0.27
R0521:Map1a UTSW 2 121305753 missense probably damaging 1.00
R0601:Map1a UTSW 2 121298602 missense probably damaging 1.00
R0619:Map1a UTSW 2 121305255 missense probably damaging 0.96
R0633:Map1a UTSW 2 121308014 missense probably damaging 1.00
R0652:Map1a UTSW 2 121302783 missense probably benign 0.04
R0893:Map1a UTSW 2 121300533 missense probably damaging 1.00
R0960:Map1a UTSW 2 121301643 missense probably benign 0.16
R1115:Map1a UTSW 2 121307378 splice site probably null
R1166:Map1a UTSW 2 121300260 missense probably damaging 1.00
R1326:Map1a UTSW 2 121306190 nonsense probably null
R1331:Map1a UTSW 2 121306220 nonsense probably null
R1395:Map1a UTSW 2 121303925 missense probably benign 0.26
R1489:Map1a UTSW 2 121300437 missense possibly damaging 0.91
R1573:Map1a UTSW 2 121304126 missense probably benign 0.37
R1596:Map1a UTSW 2 121289765 missense probably benign 0.00
R1662:Map1a UTSW 2 121306408 missense possibly damaging 0.90
R1675:Map1a UTSW 2 121302655 nonsense probably null
R1919:Map1a UTSW 2 121307012 missense probably damaging 1.00
R2122:Map1a UTSW 2 121299446 missense probably damaging 1.00
R2126:Map1a UTSW 2 121298641 missense probably damaging 0.96
R2143:Map1a UTSW 2 121301945 missense probably damaging 1.00
R2172:Map1a UTSW 2 121307932 missense probably damaging 1.00
R2249:Map1a UTSW 2 121300287 missense probably damaging 1.00
R2254:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R2255:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R3834:Map1a UTSW 2 121307322 missense probably damaging 1.00
R4011:Map1a UTSW 2 121300127 missense probably damaging 1.00
R4346:Map1a UTSW 2 121301325 missense probably benign 0.13
R4842:Map1a UTSW 2 121302086 missense probably damaging 1.00
R4933:Map1a UTSW 2 121305905 missense probably damaging 1.00
R4978:Map1a UTSW 2 121301142 missense probably benign 0.00
R4988:Map1a UTSW 2 121303050 missense probably benign 0.34
R5026:Map1a UTSW 2 121307538 missense possibly damaging 0.83
R5086:Map1a UTSW 2 121304504 missense probably damaging 1.00
R5155:Map1a UTSW 2 121302386 missense probably damaging 1.00
R5232:Map1a UTSW 2 121301985 missense probably damaging 1.00
R5311:Map1a UTSW 2 121302387 missense probably damaging 1.00
R5401:Map1a UTSW 2 121299672 missense probably damaging 1.00
R5465:Map1a UTSW 2 121306025 missense probably damaging 1.00
R5526:Map1a UTSW 2 121305662 missense probably damaging 1.00
R5642:Map1a UTSW 2 121306043 missense probably damaging 1.00
R5726:Map1a UTSW 2 121305065 missense probably damaging 1.00
R5817:Map1a UTSW 2 121298910 missense possibly damaging 0.81
R5855:Map1a UTSW 2 121303674 missense possibly damaging 0.74
R5917:Map1a UTSW 2 121305216 missense probably damaging 1.00
R5974:Map1a UTSW 2 121304376 missense probably benign 0.20
R5987:Map1a UTSW 2 121304295 missense possibly damaging 0.56
R6406:Map1a UTSW 2 121300743 missense probably damaging 1.00
R7014:Map1a UTSW 2 121300239 missense probably damaging 1.00
R7099:Map1a UTSW 2 121300517 missense probably benign 0.04
R7211:Map1a UTSW 2 121304643 missense probably benign 0.02
R7230:Map1a UTSW 2 121300818 missense probably damaging 1.00
R7305:Map1a UTSW 2 121299458 missense probably damaging 1.00
R7382:Map1a UTSW 2 121290785 missense probably damaging 1.00
R7524:Map1a UTSW 2 121289812 missense probably damaging 1.00
R7699:Map1a UTSW 2 121299720 missense probably damaging 1.00
R7767:Map1a UTSW 2 121302036 missense probably damaging 1.00
R7883:Map1a UTSW 2 121305372 missense probably damaging 1.00
R7896:Map1a UTSW 2 121305176 missense probably benign 0.00
R7993:Map1a UTSW 2 121304576 missense possibly damaging 0.84
R8270:Map1a UTSW 2 121299020 missense probably damaging 0.99
R8365:Map1a UTSW 2 121308047 missense probably damaging 1.00
R8428:Map1a UTSW 2 121304937 missense probably benign 0.42
R8490:Map1a UTSW 2 121304564 missense possibly damaging 0.93
R8678:Map1a UTSW 2 121307256 missense probably damaging 1.00
R8798:Map1a UTSW 2 121302287 missense probably benign 0.20
R8857:Map1a UTSW 2 121307617 missense probably damaging 1.00
R8878:Map1a UTSW 2 121307644 missense probably damaging 1.00
R8909:Map1a UTSW 2 121298910 missense probably damaging 0.99
R8917:Map1a UTSW 2 121301310 missense possibly damaging 0.93
R8947:Map1a UTSW 2 121304969 missense probably benign 0.27
R9069:Map1a UTSW 2 121303664 missense probably benign 0.15
R9198:Map1a UTSW 2 121303373 missense probably benign 0.00
R9253:Map1a UTSW 2 121302342 missense probably benign 0.00
R9290:Map1a UTSW 2 121300533 missense probably damaging 1.00
R9300:Map1a UTSW 2 121302965 missense probably damaging 1.00
R9589:Map1a UTSW 2 121305917 missense probably damaging 1.00
R9680:Map1a UTSW 2 121302384 missense probably damaging 1.00
R9792:Map1a UTSW 2 121290823 critical splice donor site probably null
R9793:Map1a UTSW 2 121290823 critical splice donor site probably null
R9795:Map1a UTSW 2 121290823 critical splice donor site probably null
RF003:Map1a UTSW 2 121306296 small insertion probably benign
RF007:Map1a UTSW 2 121306308 small insertion probably benign
RF009:Map1a UTSW 2 121306301 small insertion probably benign
RF010:Map1a UTSW 2 121306318 small insertion probably benign
RF014:Map1a UTSW 2 121306295 small insertion probably benign
RF017:Map1a UTSW 2 121306308 small insertion probably benign
RF024:Map1a UTSW 2 121306307 small insertion probably benign
RF025:Map1a UTSW 2 121306294 small insertion probably benign
RF030:Map1a UTSW 2 121306311 small insertion probably benign
RF030:Map1a UTSW 2 121306317 small insertion probably benign
RF033:Map1a UTSW 2 121306299 small insertion probably benign
RF034:Map1a UTSW 2 121306304 small insertion probably benign
RF034:Map1a UTSW 2 121306307 small insertion probably benign
RF035:Map1a UTSW 2 121306301 small insertion probably benign
RF037:Map1a UTSW 2 121306294 small insertion probably benign
RF039:Map1a UTSW 2 121306304 small insertion probably benign
RF042:Map1a UTSW 2 121306287 small insertion probably benign
RF044:Map1a UTSW 2 121306293 small insertion probably benign
RF045:Map1a UTSW 2 121306293 small insertion probably benign
RF051:Map1a UTSW 2 121306296 small insertion probably benign
RF052:Map1a UTSW 2 121306295 small insertion probably benign
RF053:Map1a UTSW 2 121306290 small insertion probably benign
RF060:Map1a UTSW 2 121306318 small insertion probably benign
RF061:Map1a UTSW 2 121306287 small insertion probably benign
Z1176:Map1a UTSW 2 121303238 missense possibly damaging 0.95
Z1177:Map1a UTSW 2 121305279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTAAGAACCGCGCGCACTC -3'
(R):5'- CACATTCATGGAAGATGCAGGTG -3'

Sequencing Primer
(F):5'- AGTTTCCATGGCGACCGAAG -3'
(R):5'- GACAGGGTCGCAGGTTTC -3'
Posted On 2017-10-10