Incidental Mutation 'R6151:Col24a1'
ID489234
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Namecollagen, type XXIV, alpha 1
Synonyms5430404K19Rik
MMRRC Submission 044298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6151 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location145292472-145552011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145314054 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 62 (T62I)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
Predicted Effect probably damaging
Transcript: ENSMUST00000029848
AA Change: T62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: T62I

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145362309 missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145461470 missense probably benign 0.00
IGL01160:Col24a1 APN 3 145507713 missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145314876 missense probably benign 0.07
IGL01409:Col24a1 APN 3 145538564 missense probably benign 0.19
IGL01587:Col24a1 APN 3 145433355 splice site probably null
IGL01666:Col24a1 APN 3 145344686 missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145524263 splice site probably benign
IGL01721:Col24a1 APN 3 145538567 missense probably benign 0.26
IGL01939:Col24a1 APN 3 145315244 missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145524167 splice site probably null
IGL02002:Col24a1 APN 3 145356944 missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145314962 missense probably benign 0.34
IGL02552:Col24a1 APN 3 145474207 missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145314173 missense probably benign
IGL02582:Col24a1 APN 3 145314486 missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145492301 nonsense probably null
IGL02942:Col24a1 APN 3 145541665 missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145538703 critical splice donor site probably null
IGL03108:Col24a1 APN 3 145323401 missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145313983 splice site probably benign
IGL03405:Col24a1 APN 3 145315157 missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145524142 missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145545316 splice site probably benign
R0556:Col24a1 UTSW 3 145314728 missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 145293145 missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145314120 missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145328759 missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145460838 missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145389600 critical splice donor site probably null
R1713:Col24a1 UTSW 3 145366869 nonsense probably null
R1854:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145537267 critical splice donor site probably null
R1969:Col24a1 UTSW 3 145314930 missense probably benign 0.03
R2216:Col24a1 UTSW 3 145314981 missense probably benign 0.34
R2290:Col24a1 UTSW 3 145513195 missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145337860 missense probably benign 0.01
R3772:Col24a1 UTSW 3 145545286 missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145461437 missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145524282 nonsense probably null
R4433:Col24a1 UTSW 3 145314383 missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145314383 missense probably benign 0.00
R4972:Col24a1 UTSW 3 145509684 missense probably benign 0.42
R5157:Col24a1 UTSW 3 145345951 nonsense probably null
R5216:Col24a1 UTSW 3 145315310 missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145484678 missense probably benign 0.03
R5334:Col24a1 UTSW 3 145461525 missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145315025 nonsense probably null
R5473:Col24a1 UTSW 3 145537261 missense probably benign 0.41
R5538:Col24a1 UTSW 3 145293121 missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145298827 missense probably benign 0.26
R5648:Col24a1 UTSW 3 145358566 missense probably benign 0.00
R5920:Col24a1 UTSW 3 145428230 missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145314380 missense probably benign 0.00
R6728:Col24a1 UTSW 3 145315196 missense probably benign
R6734:Col24a1 UTSW 3 145508674 missense probably benign 0.06
R6861:Col24a1 UTSW 3 145460834 missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145315046 nonsense probably null
R7001:Col24a1 UTSW 3 145298866 missense probably benign 0.28
R7148:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145486304 nonsense probably null
R7315:Col24a1 UTSW 3 145431870 missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 145293165 critical splice donor site probably null
R7371:Col24a1 UTSW 3 145343698 missense probably benign 0.06
R7383:Col24a1 UTSW 3 145298838 missense probably benign
R7605:Col24a1 UTSW 3 145538687 missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145314453 missense probably benign 0.00
R7679:Col24a1 UTSW 3 145399355 missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145315011 missense probably benign
R7701:Col24a1 UTSW 3 145366901 splice site probably null
R7805:Col24a1 UTSW 3 145314140 missense probably benign 0.02
R7913:Col24a1 UTSW 3 145431866 nonsense probably null
R8056:Col24a1 UTSW 3 145314164 missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145507702 missense probably benign 0.31
R8294:Col24a1 UTSW 3 145481089 missense probably null 1.00
R8305:Col24a1 UTSW 3 145474182 missense probably benign 0.00
Z1176:Col24a1 UTSW 3 145342498 missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145342499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCATGGGTAGAACATGC -3'
(R):5'- CCAAACTGCAGTCTGTTGTTATTCC -3'

Sequencing Primer
(F):5'- GCTCATGGGTAGAACATGCTTATATC -3'
(R):5'- GCTGAAGAGAAATGCATTGTTCAC -3'
Posted On2017-10-10