Mutagenetix > Incidental Mutation

Incidental Mutation 'R6151:Col24a1'

489234

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

044298-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6151 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 145314054 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 62 (T62I)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]

AlphaFold

Q30D77

Predicted Effect

probably damaging
Transcript: ENSMUST00000029848
AA Change: T62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: T62I

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139001

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	T	13: 66,431,681	C248S	probably damaging	Het
3110009E18Rik	A	G	1: 120,171,486		probably null	Het
4930550C14Rik	G	T	9: 53,414,383	R73S	probably damaging	Het
Abca1	A	G	4: 53,085,261	V517A	probably benign	Het
Adck5	A	T	15: 76,594,687	K370N	possibly damaging	Het
Akap6	A	C	12: 53,025,792	D981A	probably damaging	Het
Apbb1	G	A	7: 105,574,252	R51*	probably null	Het
Arhgap23	A	G	11: 97,500,412	M1252V	probably benign	Het
Arhgef1	A	G	7: 24,917,942	T354A	probably benign	Het
Arid1a	G	T	4: 133,684,976	Q1636K	unknown	Het
Asmt	C	T	X: 170,676,467	A237V	possibly damaging	Het
Brat1	T	A	5: 140,705,961	C43S	probably benign	Het
Cd36	T	C	5: 17,795,595	Y370C	probably damaging	Het
Ceacam12	A	T	7: 18,069,105	L145F	probably benign	Het
Col6a3	G	T	1: 90,813,753	N652K	possibly damaging	Het
Dcbld1	T	C	10: 52,304,660	L140P	probably damaging	Het
Dhrs13	G	A	11: 78,036,982	C218Y	probably damaging	Het
Diaph1	T	G	18: 37,853,353	E1158A	probably damaging	Het
Emp2	A	C	16: 10,292,281	F20C	probably damaging	Het
Enpep	T	C	3: 129,332,418	I22V	possibly damaging	Het
Epha2	A	G	4: 141,318,480		probably null	Het
Eprs	G	T	1: 185,407,754		probably null	Het
Etl4	T	A	2: 20,713,360	I304N	probably damaging	Het
Exoc3l2	C	A	7: 19,491,745	S89*	probably null	Het
F5	A	T	1: 164,181,635	I325F	probably damaging	Het
F5	G	A	1: 164,190,187	C611Y	probably damaging	Het
Fam133b	A	T	5: 3,559,133	S116C	probably null	Het
Fam13b	A	T	18: 34,494,277	D190E	probably damaging	Het
Fam169a	T	G	13: 97,093,630	Y58D	probably damaging	Het
Far1	G	A	7: 113,561,396	R383H	possibly damaging	Het
Fnbp1l	T	C	3: 122,570,930	K52R	possibly damaging	Het
Foxj3	C	A	4: 119,623,271	Q469K	unknown	Het
Frs3	A	T	17: 47,689,088		probably benign	Het
Gdpd3	A	G	7: 126,775,502	S290G	probably benign	Het
Gm6768	T	G	12: 119,261,106		noncoding transcript	Het
Gmip	T	A	8: 69,817,085	L610Q	probably damaging	Het
Gprc5c	T	A	11: 114,864,025	I176N	probably damaging	Het
Grm3	A	G	5: 9,511,556	F765L	probably damaging	Het
Hhat	A	T	1: 192,759,757	L2Q	probably damaging	Het
Hrasls5	C	T	19: 7,619,291	P148S	probably damaging	Het
Hspbap1	T	C	16: 35,817,222	S214P	probably damaging	Het
Ighv1-62-3	C	A	12: 115,461,289	V21F	probably damaging	Het
Kcnj15	A	T	16: 95,295,668	K50*	probably null	Het
Kidins220	T	C	12: 25,056,909	S1454P	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Klhl23	T	G	2: 69,824,854	L356R	probably damaging	Het
Kndc1	A	T	7: 139,921,213	D806V	probably benign	Het
Krt26	T	C	11: 99,337,489	E139G	probably benign	Het
Lefty1	T	C	1: 180,935,116	F3L	unknown	Het
Madd	A	C	2: 91,165,457	Y853*	probably null	Het
Map1a	T	A	2: 121,289,823	D63E	probably benign	Het
Mdn1	T	A	4: 32,684,735	V815E	probably damaging	Het
Mettl3	A	G	14: 52,295,020	Y569H	probably damaging	Het
Mknk2	T	C	10: 80,669,025		probably null	Het
Mpp3	C	A	11: 102,008,566	R376S	probably benign	Het
Nup160	T	A	2: 90,690,105	Y293*	probably null	Het
Nupl1	A	T	14: 60,244,616	F100I	possibly damaging	Het
Nxpe2	A	C	9: 48,326,191	L255V	probably benign	Het
Olfr1423	T	C	19: 12,036,736	E2G	probably benign	Het
Olfr167	A	T	16: 19,515,531	L35Q	probably damaging	Het
Olfr390	T	A	11: 73,787,695	Y252*	probably null	Het
Olfr479	A	G	7: 108,055,899	I306V	probably benign	Het
Padi3	A	T	4: 140,796,394	D248E	probably damaging	Het
Paxip1	G	T	5: 27,761,618	H637N	probably damaging	Het
Pde4b	T	A	4: 102,601,551	M296K	probably damaging	Het
Pkd1	A	G	17: 24,575,606	H2089R	probably benign	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rhebl1	T	C	15: 98,878,279	I165V	probably benign	Het
Rock1	A	T	18: 10,106,426	V481E	possibly damaging	Het
Rtca	T	A	3: 116,507,827	T24S	probably benign	Het
Serpina3c	T	A	12: 104,152,068	I4F	possibly damaging	Het
Serpina3j	C	A	12: 104,317,390	A249E	possibly damaging	Het
Slc38a9	A	G	13: 112,689,376	N116S	probably damaging	Het
Slco2b1	C	T	7: 99,690,563	V58I	possibly damaging	Het
Slfn8	T	A	11: 83,017,321	Y132F	probably damaging	Het
Smg6	T	G	11: 75,156,207	I1242S	probably damaging	Het
Tap2	G	T	17: 34,212,047	V374L	probably benign	Het
Tbc1d10b	G	A	7: 127,207,996	T123M	probably damaging	Het
Tenm2	A	C	11: 36,008,783	V2516G	probably damaging	Het
Tenm3	C	T	8: 48,395,573	R12Q	probably damaging	Het
Tmem130	T	A	5: 144,737,851	M355L	probably benign	Het
Tns4	C	T	11: 99,075,550	S433N	probably benign	Het
Traip	G	T	9: 107,970,619		probably null	Het
Trmo	G	A	4: 46,389,390	R2C	probably damaging	Het
Ttn	A	T	2: 76,944,160	I2134N	probably damaging	Het
Uba1y	A	G	Y: 825,984	D380G	probably benign	Het
Ube2t	T	A	1: 134,967,960		probably null	Het
Ugdh	A	T	5: 65,417,581	Y367*	probably null	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vmn1r84	G	T	7: 12,361,914	T284K	possibly damaging	Het
Vmn1r91	T	A	7: 20,101,435	F93Y	probably benign	Het
Vmn2r77	T	A	7: 86,801,670	Y255N	probably benign	Het
Vmn2r96	A	T	17: 18,583,959	Q490H	probably benign	Het
Vwa2	A	G	19: 56,903,465		probably null	Het
Vwf	A	G	6: 125,657,065	K169E	unknown	Het
Zc3h7b	G	C	15: 81,778,710		probably null	Het
Zfp458	T	A	13: 67,257,598	H259L	possibly damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp804b	A	G	5: 6,769,910	V1051A	probably benign	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCATGGGTAGAACATGC -3'
(R):5'- CCAAACTGCAGTCTGTTGTTATTCC -3'

Sequencing Primer
(F):5'- GCTCATGGGTAGAACATGCTTATATC -3'
(R):5'- GCTGAAGAGAAATGCATTGTTCAC -3'

Posted On

2017-10-10