Incidental Mutation 'R6151:Apbb1'
ID489261
Institutional Source Beutler Lab
Gene Symbol Apbb1
Ensembl Gene ENSMUSG00000037032
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1
SynonymsFe65, Rir
MMRRC Submission 044298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6151 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105558483-105581653 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 105574252 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 51 (R51*)
Ref Sequence ENSEMBL: ENSMUSP00000140116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081165] [ENSMUST00000186868] [ENSMUST00000187051] [ENSMUST00000187683] [ENSMUST00000188440] [ENSMUST00000188726] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601] [ENSMUST00000210079]
Predicted Effect probably null
Transcript: ENSMUST00000081165
AA Change: R51*
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032
AA Change: R51*

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186868
SMART Domains Protein: ENSMUSP00000140052
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187051
SMART Domains Protein: ENSMUSP00000139755
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
SCOP:d1shca_ 74 120 9e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187683
SMART Domains Protein: ENSMUSP00000139426
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 2.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Pfam:PID 111 158 5.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188440
SMART Domains Protein: ENSMUSP00000140715
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 3.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 223 1.4e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188726
AA Change: R51*
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189378
AA Change: R51*
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032
AA Change: R51*

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191011
AA Change: R51*
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032
AA Change: R51*

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191601
AA Change: R51*
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032
AA Change: R51*

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210079
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a null allele are hypersensitive to ionizing radiation while mouse embryonic fibroblasts are hypersensitive to DNA damaging agents. Homozygotes for a second null allele display impaired performance in learning and memory tasks, with a striking deficit in reversal spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Apbb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Apbb1 APN 7 105559126 splice site probably benign
athena UTSW 7 105566695 missense probably benign
R0092:Apbb1 UTSW 7 105559154 missense probably damaging 1.00
R0348:Apbb1 UTSW 7 105565303 missense probably damaging 0.98
R0633:Apbb1 UTSW 7 105558963 missense probably damaging 1.00
R0946:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1076:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1332:Apbb1 UTSW 7 105565543 missense possibly damaging 0.74
R1658:Apbb1 UTSW 7 105574084 missense probably damaging 1.00
R1739:Apbb1 UTSW 7 105574227 missense probably benign
R4230:Apbb1 UTSW 7 105567684 missense probably damaging 1.00
R4296:Apbb1 UTSW 7 105573826 missense probably benign 0.16
R4385:Apbb1 UTSW 7 105567276 missense probably benign 0.00
R4571:Apbb1 UTSW 7 105573762 missense probably damaging 1.00
R4647:Apbb1 UTSW 7 105565538 missense probably benign 0.01
R4812:Apbb1 UTSW 7 105574025 missense probably damaging 0.99
R5044:Apbb1 UTSW 7 105565682 intron probably benign
R5109:Apbb1 UTSW 7 105565035 missense probably damaging 1.00
R5479:Apbb1 UTSW 7 105565025 missense probably damaging 0.97
R5611:Apbb1 UTSW 7 105559483 missense probably damaging 1.00
R5677:Apbb1 UTSW 7 105559246 missense probably damaging 1.00
R5785:Apbb1 UTSW 7 105567715 missense probably damaging 1.00
R5850:Apbb1 UTSW 7 105567583 missense probably damaging 1.00
R5896:Apbb1 UTSW 7 105574225 missense probably damaging 1.00
R6186:Apbb1 UTSW 7 105567726 missense probably damaging 1.00
R6229:Apbb1 UTSW 7 105573730 missense probably damaging 0.98
R6229:Apbb1 UTSW 7 105573731 missense probably damaging 0.98
R6288:Apbb1 UTSW 7 105559227 missense probably damaging 1.00
R6295:Apbb1 UTSW 7 105566695 missense probably benign
R6443:Apbb1 UTSW 7 105573763 missense probably damaging 1.00
R6729:Apbb1 UTSW 7 105565381 missense probably damaging 1.00
R7130:Apbb1 UTSW 7 105565331 missense probably damaging 0.98
R7209:Apbb1 UTSW 7 105566085 missense probably damaging 1.00
R7467:Apbb1 UTSW 7 105566132 missense probably benign 0.04
R7489:Apbb1 UTSW 7 105567480 missense probably benign 0.30
R7588:Apbb1 UTSW 7 105573966 missense probably benign 0.29
R7754:Apbb1 UTSW 7 105559302 missense probably damaging 0.97
R7768:Apbb1 UTSW 7 105567088 missense probably benign
R7785:Apbb1 UTSW 7 105567423 missense probably benign 0.00
R7804:Apbb1 UTSW 7 105566600 missense probably damaging 1.00
R7809:Apbb1 UTSW 7 105573807 missense probably benign 0.04
R7995:Apbb1 UTSW 7 105565645 missense probably benign 0.09
R8044:Apbb1 UTSW 7 105573887 small deletion probably benign
Z1088:Apbb1 UTSW 7 105559136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCATTAAGCCTTTGGGACCC -3'
(R):5'- TAAGTCTGGGGCAGCAACAG -3'

Sequencing Primer
(F):5'- CAAAGGTGCCGTCTCAGC -3'
(R):5'- GGAACACTCAACATGGTCTCTC -3'
Posted On2017-10-10