Incidental Mutation 'R6151:Or10ab4'
ID 489262
Institutional Source Beutler Lab
Gene Symbol Or10ab4
Ensembl Gene ENSMUSG00000043855
Gene Name olfactory receptor family 10 subfamily AB member 4
Synonyms Olfr479, MOR267-15, GA_x6K02T2PBJ9-10384085-10385068
MMRRC Submission 044298-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6151 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 107654191-107655174 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107655106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 306 (I306V)
Ref Sequence ENSEMBL: ENSMUSP00000149060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063151] [ENSMUST00000209805] [ENSMUST00000214599]
AlphaFold Q7TRV1
Predicted Effect probably benign
Transcript: ENSMUST00000063151
AA Change: I306V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056631
Gene: ENSMUSG00000043855
AA Change: I306V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.5e-45 PFAM
Pfam:7tm_1 39 301 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209805
AA Change: I306V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214599
AA Change: I306V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,099,216 (GRCm39) probably null Het
4930550C14Rik G T 9: 53,325,683 (GRCm39) R73S probably damaging Het
Abca1 A G 4: 53,085,261 (GRCm39) V517A probably benign Het
Adck5 A T 15: 76,478,887 (GRCm39) K370N possibly damaging Het
Akap6 A C 12: 53,072,575 (GRCm39) D981A probably damaging Het
Apbb1 G A 7: 105,223,459 (GRCm39) R51* probably null Het
Arhgap23 A G 11: 97,391,238 (GRCm39) M1252V probably benign Het
Arhgef1 A G 7: 24,617,367 (GRCm39) T354A probably benign Het
Arid1a G T 4: 133,412,287 (GRCm39) Q1636K unknown Het
Asmt C T X: 169,110,202 (GRCm39) A237V possibly damaging Het
Brat1 T A 5: 140,691,716 (GRCm39) C43S probably benign Het
Cd36 T C 5: 18,000,593 (GRCm39) Y370C probably damaging Het
Ceacam12 A T 7: 17,803,030 (GRCm39) L145F probably benign Het
Col24a1 C T 3: 145,019,815 (GRCm39) T62I probably damaging Het
Col6a3 G T 1: 90,741,475 (GRCm39) N652K possibly damaging Het
Dcbld1 T C 10: 52,180,756 (GRCm39) L140P probably damaging Het
Dhrs13 G A 11: 77,927,808 (GRCm39) C218Y probably damaging Het
Diaph1 T G 18: 37,986,406 (GRCm39) E1158A probably damaging Het
Emp2 A C 16: 10,110,145 (GRCm39) F20C probably damaging Het
Enpep T C 3: 129,126,067 (GRCm39) I22V possibly damaging Het
Epha2 A G 4: 141,045,791 (GRCm39) probably null Het
Eprs1 G T 1: 185,139,951 (GRCm39) probably null Het
Etl4 T A 2: 20,718,171 (GRCm39) I304N probably damaging Het
Exoc3l2 C A 7: 19,225,670 (GRCm39) S89* probably null Het
F5 A T 1: 164,009,204 (GRCm39) I325F probably damaging Het
F5 G A 1: 164,017,756 (GRCm39) C611Y probably damaging Het
Fam133b A T 5: 3,609,133 (GRCm39) S116C probably null Het
Fam13b A T 18: 34,627,330 (GRCm39) D190E probably damaging Het
Fam169a T G 13: 97,230,138 (GRCm39) Y58D probably damaging Het
Far1 G A 7: 113,160,603 (GRCm39) R383H possibly damaging Het
Fnbp1l T C 3: 122,364,579 (GRCm39) K52R possibly damaging Het
Foxj3 C A 4: 119,480,468 (GRCm39) Q469K unknown Het
Frs3 A T 17: 48,000,013 (GRCm39) probably benign Het
Gdpd3 A G 7: 126,374,674 (GRCm39) S290G probably benign Het
Gmip T A 8: 70,269,735 (GRCm39) L610Q probably damaging Het
Gprc5c T A 11: 114,754,851 (GRCm39) I176N probably damaging Het
Grm3 A G 5: 9,561,556 (GRCm39) F765L probably damaging Het
Hhat A T 1: 192,442,065 (GRCm39) L2Q probably damaging Het
Hspbap1 T C 16: 35,637,592 (GRCm39) S214P probably damaging Het
Ighv1-62-3 C A 12: 115,424,909 (GRCm39) V21F probably damaging Het
Kcnj15 A T 16: 95,096,527 (GRCm39) K50* probably null Het
Kidins220 T C 12: 25,106,908 (GRCm39) S1454P possibly damaging Het
Kl T A 5: 150,912,318 (GRCm39) M689K possibly damaging Het
Klhl23 T G 2: 69,655,198 (GRCm39) L356R probably damaging Het
Kndc1 A T 7: 139,501,129 (GRCm39) D806V probably benign Het
Krt26 T C 11: 99,228,315 (GRCm39) E139G probably benign Het
Lefty1 T C 1: 180,762,681 (GRCm39) F3L unknown Het
Madd A C 2: 90,995,802 (GRCm39) Y853* probably null Het
Map1a T A 2: 121,120,304 (GRCm39) D63E probably benign Het
Mdn1 T A 4: 32,684,735 (GRCm39) V815E probably damaging Het
Mettl3 A G 14: 52,532,477 (GRCm39) Y569H probably damaging Het
Mknk2 T C 10: 80,504,859 (GRCm39) probably null Het
Mpp3 C A 11: 101,899,392 (GRCm39) R376S probably benign Het
Ncoa4-ps T G 12: 119,224,841 (GRCm39) noncoding transcript Het
Nup160 T A 2: 90,520,449 (GRCm39) Y293* probably null Het
Nup58 A T 14: 60,482,065 (GRCm39) F100I possibly damaging Het
Nxpe2 A C 9: 48,237,491 (GRCm39) L255V probably benign Het
Or1e30 T A 11: 73,678,521 (GRCm39) Y252* probably null Het
Or2l5 A T 16: 19,334,281 (GRCm39) L35Q probably damaging Het
Or4d11 T C 19: 12,014,100 (GRCm39) E2G probably benign Het
Padi3 A T 4: 140,523,705 (GRCm39) D248E probably damaging Het
Paxip1 G T 5: 27,966,616 (GRCm39) H637N probably damaging Het
Pde4b T A 4: 102,458,748 (GRCm39) M296K probably damaging Het
Pkd1 A G 17: 24,794,580 (GRCm39) H2089R probably benign Het
Plaat5 C T 19: 7,596,656 (GRCm39) P148S probably damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Rhebl1 T C 15: 98,776,160 (GRCm39) I165V probably benign Het
Rock1 A T 18: 10,106,426 (GRCm39) V481E possibly damaging Het
Rtca T A 3: 116,301,476 (GRCm39) T24S probably benign Het
Serpina3c T A 12: 104,118,327 (GRCm39) I4F possibly damaging Het
Serpina3j C A 12: 104,283,649 (GRCm39) A249E possibly damaging Het
Slc38a9 A G 13: 112,825,910 (GRCm39) N116S probably damaging Het
Slco2b1 C T 7: 99,339,770 (GRCm39) V58I possibly damaging Het
Slfn8 T A 11: 82,908,147 (GRCm39) Y132F probably damaging Het
Smg6 T G 11: 75,047,033 (GRCm39) I1242S probably damaging Het
Tap2 G T 17: 34,431,021 (GRCm39) V374L probably benign Het
Tbc1d10b G A 7: 126,807,168 (GRCm39) T123M probably damaging Het
Tenm2 A C 11: 35,899,610 (GRCm39) V2516G probably damaging Het
Tenm3 C T 8: 48,848,608 (GRCm39) R12Q probably damaging Het
Tmem130 T A 5: 144,674,661 (GRCm39) M355L probably benign Het
Tns4 C T 11: 98,966,376 (GRCm39) S433N probably benign Het
Traip G T 9: 107,847,818 (GRCm39) probably null Het
Trmo G A 4: 46,389,390 (GRCm39) R2C probably damaging Het
Ttn A T 2: 76,774,504 (GRCm39) I2134N probably damaging Het
Uba1y A G Y: 825,984 (GRCm39) D380G probably benign Het
Ube2t T A 1: 134,895,698 (GRCm39) probably null Het
Ugdh A T 5: 65,574,924 (GRCm39) Y367* probably null Het
Usp45 A C 4: 21,810,797 (GRCm39) D331A probably damaging Het
Vmn1r84 G T 7: 12,095,841 (GRCm39) T284K possibly damaging Het
Vmn1r91 T A 7: 19,835,360 (GRCm39) F93Y probably benign Het
Vmn2r77 T A 7: 86,450,878 (GRCm39) Y255N probably benign Het
Vmn2r96 A T 17: 18,804,221 (GRCm39) Q490H probably benign Het
Vwa2 A G 19: 56,891,897 (GRCm39) probably null Het
Vwf A G 6: 125,634,028 (GRCm39) K169E unknown Het
Zc3h7b G C 15: 81,662,911 (GRCm39) probably null Het
Zfp458 T A 13: 67,405,662 (GRCm39) H259L possibly damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp804b A G 5: 6,819,910 (GRCm39) V1051A probably benign Het
Zfp998 A T 13: 66,579,740 (GRCm39) C248S probably damaging Het
Other mutations in Or10ab4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Or10ab4 APN 7 107,654,774 (GRCm39) missense probably damaging 0.96
IGL01320:Or10ab4 APN 7 107,654,188 (GRCm39) utr 5 prime probably benign
IGL01322:Or10ab4 APN 7 107,654,188 (GRCm39) utr 5 prime probably benign
R0396:Or10ab4 UTSW 7 107,655,170 (GRCm39) missense probably benign 0.11
R0539:Or10ab4 UTSW 7 107,655,029 (GRCm39) missense probably damaging 1.00
R2129:Or10ab4 UTSW 7 107,655,111 (GRCm39) missense probably benign 0.25
R2246:Or10ab4 UTSW 7 107,654,989 (GRCm39) missense probably benign 0.00
R2247:Or10ab4 UTSW 7 107,654,989 (GRCm39) missense probably benign 0.00
R3149:Or10ab4 UTSW 7 107,654,989 (GRCm39) missense probably benign 0.00
R3709:Or10ab4 UTSW 7 107,655,004 (GRCm39) missense possibly damaging 0.63
R3714:Or10ab4 UTSW 7 107,654,642 (GRCm39) missense probably damaging 0.99
R4326:Or10ab4 UTSW 7 107,654,362 (GRCm39) missense probably damaging 1.00
R4962:Or10ab4 UTSW 7 107,654,647 (GRCm39) missense probably benign 0.27
R5053:Or10ab4 UTSW 7 107,654,741 (GRCm39) missense probably benign 0.10
R5976:Or10ab4 UTSW 7 107,655,005 (GRCm39) missense possibly damaging 0.89
R6939:Or10ab4 UTSW 7 107,654,312 (GRCm39) missense possibly damaging 0.87
R7271:Or10ab4 UTSW 7 107,654,423 (GRCm39) missense probably damaging 1.00
R8956:Or10ab4 UTSW 7 107,655,160 (GRCm39) missense probably benign 0.13
R9250:Or10ab4 UTSW 7 107,655,014 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGGCTTTCTCAACGTGCTCC -3'
(R):5'- TTTGCTATAGGAAAATGGTGAGACC -3'

Sequencing Primer
(F):5'- CACAGTTGTTTCTATGCACTATGG -3'
(R):5'- CCAGGACAGTTCATGCAGTTAGAC -3'
Posted On 2017-10-10