Incidental Mutation 'R6151:Far1'
ID489263
Institutional Source Beutler Lab
Gene Symbol Far1
Ensembl Gene ENSMUSG00000030759
Gene Namefatty acyl CoA reductase 1
SynonymsMlstd2, 3732409C05Rik, 2600011M19Rik, 2900034E22Rik
MMRRC Submission 044298-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R6151 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location113513834-113571511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113561396 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 383 (R383H)
Ref Sequence ENSEMBL: ENSMUSP00000128695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033018] [ENSMUST00000067929] [ENSMUST00000164745]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033018
AA Change: R383H

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033018
Gene: ENSMUSG00000030759
AA Change: R383H

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 3.1e-34 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000067929
AA Change: R383H

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064334
Gene: ENSMUSG00000030759
AA Change: R383H

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 5.4e-36 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155183
Predicted Effect possibly damaging
Transcript: ENSMUST00000164745
AA Change: R383H

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128695
Gene: ENSMUSG00000030759
AA Change: R383H

DomainStartEndE-ValueType
Pfam:Epimerase 13 241 1.5e-10 PFAM
Pfam:NAD_binding_4 15 285 9.9e-78 PFAM
Pfam:Sterile 355 448 5.8e-26 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the reduction of fatty acids to fatty alcohols, a process that is required for the synthesis of monoesters and ether lipids. NADPH is required as a cofactor in this reaction, and 16-18 carbon saturated and unsaturated fatty acids are the preferred substrate. This is a peroxisomal membrane protein, and studies suggest that the N-terminus contains a large catalytic domain located on the outside of the peroxisome, while the C-terminus is exposed to the matrix of the peroxisome. Studies indicate that the regulation of this protein is dependent on plasmalogen levels. Mutations in this gene have been associated with individuals affected by severe intellectual disability, early-onset epilepsy, microcephaly, congenital cataracts, growth retardation, and spasticity (PMID: 25439727). A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Far1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Far1 APN 7 113540689 missense probably benign 0.07
IGL02597:Far1 APN 7 113551256 missense probably benign 0.31
IGL02937:Far1 APN 7 113540648 missense probably damaging 0.98
R0499:Far1 UTSW 7 113554296 intron probably benign
R2045:Far1 UTSW 7 113539271 critical splice acceptor site probably null
R2140:Far1 UTSW 7 113566460 missense possibly damaging 0.89
R2852:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R2853:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R4423:Far1 UTSW 7 113540598 missense probably damaging 1.00
R4426:Far1 UTSW 7 113550001 missense probably benign 0.08
R4801:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4802:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4898:Far1 UTSW 7 113568225 missense probably damaging 1.00
R5762:Far1 UTSW 7 113568189 missense probably damaging 0.98
R6165:Far1 UTSW 7 113554218 missense probably benign
R6278:Far1 UTSW 7 113568137 missense probably benign 0.00
R7269:Far1 UTSW 7 113561447 missense probably benign 0.00
R7356:Far1 UTSW 7 113568142 missense possibly damaging 0.94
R7853:Far1 UTSW 7 113554148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTGAATCCTTTTGCGTAGTGTG -3'
(R):5'- AAATGGCTAGGTTTCAGGGTGC -3'

Sequencing Primer
(F):5'- TCATTTGAGAATTCTGTATCAGCAG -3'
(R):5'- AGGGTGCCTACTGGTCATTTTCTAAC -3'
Posted On2017-10-10