Incidental Mutation 'R6151:Traip'
ID 489271
Institutional Source Beutler Lab
Gene Symbol Traip
Ensembl Gene ENSMUSG00000032586
Gene Name TRAF-interacting protein
Synonyms Trip
MMRRC Submission 044298-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6151 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 107828158-107849469 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 107847818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035216] [ENSMUST00000049348]
AlphaFold Q8VIG6
Predicted Effect probably benign
Transcript: ENSMUST00000035216
SMART Domains Protein: ENSMUSP00000035216
Gene: ENSMUSG00000032596

DomainStartEndE-ValueType
Pfam:ThiF 6 401 1.2e-33 PFAM
Pfam:E1_FCCH 178 249 1.1e-26 PFAM
Pfam:E1_4HB 250 318 2.5e-22 PFAM
internal_repeat_1 402 510 8.05e-5 PROSPERO
Pfam:UBA_e1_thiolCys 592 808 1.3e-50 PFAM
UBA_e1_C 846 973 4.63e-65 SMART
Predicted Effect probably null
Transcript: ENSMUST00000049348
SMART Domains Protein: ENSMUSP00000040001
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 6.68e-6 SMART
coiled coil region 70 278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195803
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an N-terminal RING finger motif and a putative coiled-coil domain. A similar murine protein interacts with TNFR-associated factor 1 (TRAF1), TNFR-associated factor 2 (TRAF2), and cylindromatosis. The interaction with TRAF2 inhibits TRAF2-mediated nuclear factor kappa-B, subunit 1 activation that is required for cell activation and protection against apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at prior to E8.5, embryonic growth retardation, decreased embryonic size, decreased cell proliferation and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(1) Gene trapped(9)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,099,216 (GRCm39) probably null Het
4930550C14Rik G T 9: 53,325,683 (GRCm39) R73S probably damaging Het
Abca1 A G 4: 53,085,261 (GRCm39) V517A probably benign Het
Adck5 A T 15: 76,478,887 (GRCm39) K370N possibly damaging Het
Akap6 A C 12: 53,072,575 (GRCm39) D981A probably damaging Het
Apbb1 G A 7: 105,223,459 (GRCm39) R51* probably null Het
Arhgap23 A G 11: 97,391,238 (GRCm39) M1252V probably benign Het
Arhgef1 A G 7: 24,617,367 (GRCm39) T354A probably benign Het
Arid1a G T 4: 133,412,287 (GRCm39) Q1636K unknown Het
Asmt C T X: 169,110,202 (GRCm39) A237V possibly damaging Het
Brat1 T A 5: 140,691,716 (GRCm39) C43S probably benign Het
Cd36 T C 5: 18,000,593 (GRCm39) Y370C probably damaging Het
Ceacam12 A T 7: 17,803,030 (GRCm39) L145F probably benign Het
Col24a1 C T 3: 145,019,815 (GRCm39) T62I probably damaging Het
Col6a3 G T 1: 90,741,475 (GRCm39) N652K possibly damaging Het
Dcbld1 T C 10: 52,180,756 (GRCm39) L140P probably damaging Het
Dhrs13 G A 11: 77,927,808 (GRCm39) C218Y probably damaging Het
Diaph1 T G 18: 37,986,406 (GRCm39) E1158A probably damaging Het
Emp2 A C 16: 10,110,145 (GRCm39) F20C probably damaging Het
Enpep T C 3: 129,126,067 (GRCm39) I22V possibly damaging Het
Epha2 A G 4: 141,045,791 (GRCm39) probably null Het
Eprs1 G T 1: 185,139,951 (GRCm39) probably null Het
Etl4 T A 2: 20,718,171 (GRCm39) I304N probably damaging Het
Exoc3l2 C A 7: 19,225,670 (GRCm39) S89* probably null Het
F5 A T 1: 164,009,204 (GRCm39) I325F probably damaging Het
F5 G A 1: 164,017,756 (GRCm39) C611Y probably damaging Het
Fam133b A T 5: 3,609,133 (GRCm39) S116C probably null Het
Fam13b A T 18: 34,627,330 (GRCm39) D190E probably damaging Het
Fam169a T G 13: 97,230,138 (GRCm39) Y58D probably damaging Het
Far1 G A 7: 113,160,603 (GRCm39) R383H possibly damaging Het
Fnbp1l T C 3: 122,364,579 (GRCm39) K52R possibly damaging Het
Foxj3 C A 4: 119,480,468 (GRCm39) Q469K unknown Het
Frs3 A T 17: 48,000,013 (GRCm39) probably benign Het
Gdpd3 A G 7: 126,374,674 (GRCm39) S290G probably benign Het
Gmip T A 8: 70,269,735 (GRCm39) L610Q probably damaging Het
Gprc5c T A 11: 114,754,851 (GRCm39) I176N probably damaging Het
Grm3 A G 5: 9,561,556 (GRCm39) F765L probably damaging Het
Hhat A T 1: 192,442,065 (GRCm39) L2Q probably damaging Het
Hspbap1 T C 16: 35,637,592 (GRCm39) S214P probably damaging Het
Ighv1-62-3 C A 12: 115,424,909 (GRCm39) V21F probably damaging Het
Kcnj15 A T 16: 95,096,527 (GRCm39) K50* probably null Het
Kidins220 T C 12: 25,106,908 (GRCm39) S1454P possibly damaging Het
Kl T A 5: 150,912,318 (GRCm39) M689K possibly damaging Het
Klhl23 T G 2: 69,655,198 (GRCm39) L356R probably damaging Het
Kndc1 A T 7: 139,501,129 (GRCm39) D806V probably benign Het
Krt26 T C 11: 99,228,315 (GRCm39) E139G probably benign Het
Lefty1 T C 1: 180,762,681 (GRCm39) F3L unknown Het
Madd A C 2: 90,995,802 (GRCm39) Y853* probably null Het
Map1a T A 2: 121,120,304 (GRCm39) D63E probably benign Het
Mdn1 T A 4: 32,684,735 (GRCm39) V815E probably damaging Het
Mettl3 A G 14: 52,532,477 (GRCm39) Y569H probably damaging Het
Mknk2 T C 10: 80,504,859 (GRCm39) probably null Het
Mpp3 C A 11: 101,899,392 (GRCm39) R376S probably benign Het
Ncoa4-ps T G 12: 119,224,841 (GRCm39) noncoding transcript Het
Nup160 T A 2: 90,520,449 (GRCm39) Y293* probably null Het
Nup58 A T 14: 60,482,065 (GRCm39) F100I possibly damaging Het
Nxpe2 A C 9: 48,237,491 (GRCm39) L255V probably benign Het
Or10ab4 A G 7: 107,655,106 (GRCm39) I306V probably benign Het
Or1e30 T A 11: 73,678,521 (GRCm39) Y252* probably null Het
Or2l5 A T 16: 19,334,281 (GRCm39) L35Q probably damaging Het
Or4d11 T C 19: 12,014,100 (GRCm39) E2G probably benign Het
Padi3 A T 4: 140,523,705 (GRCm39) D248E probably damaging Het
Paxip1 G T 5: 27,966,616 (GRCm39) H637N probably damaging Het
Pde4b T A 4: 102,458,748 (GRCm39) M296K probably damaging Het
Pkd1 A G 17: 24,794,580 (GRCm39) H2089R probably benign Het
Plaat5 C T 19: 7,596,656 (GRCm39) P148S probably damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Rhebl1 T C 15: 98,776,160 (GRCm39) I165V probably benign Het
Rock1 A T 18: 10,106,426 (GRCm39) V481E possibly damaging Het
Rtca T A 3: 116,301,476 (GRCm39) T24S probably benign Het
Serpina3c T A 12: 104,118,327 (GRCm39) I4F possibly damaging Het
Serpina3j C A 12: 104,283,649 (GRCm39) A249E possibly damaging Het
Slc38a9 A G 13: 112,825,910 (GRCm39) N116S probably damaging Het
Slco2b1 C T 7: 99,339,770 (GRCm39) V58I possibly damaging Het
Slfn8 T A 11: 82,908,147 (GRCm39) Y132F probably damaging Het
Smg6 T G 11: 75,047,033 (GRCm39) I1242S probably damaging Het
Tap2 G T 17: 34,431,021 (GRCm39) V374L probably benign Het
Tbc1d10b G A 7: 126,807,168 (GRCm39) T123M probably damaging Het
Tenm2 A C 11: 35,899,610 (GRCm39) V2516G probably damaging Het
Tenm3 C T 8: 48,848,608 (GRCm39) R12Q probably damaging Het
Tmem130 T A 5: 144,674,661 (GRCm39) M355L probably benign Het
Tns4 C T 11: 98,966,376 (GRCm39) S433N probably benign Het
Trmo G A 4: 46,389,390 (GRCm39) R2C probably damaging Het
Ttn A T 2: 76,774,504 (GRCm39) I2134N probably damaging Het
Uba1y A G Y: 825,984 (GRCm39) D380G probably benign Het
Ube2t T A 1: 134,895,698 (GRCm39) probably null Het
Ugdh A T 5: 65,574,924 (GRCm39) Y367* probably null Het
Usp45 A C 4: 21,810,797 (GRCm39) D331A probably damaging Het
Vmn1r84 G T 7: 12,095,841 (GRCm39) T284K possibly damaging Het
Vmn1r91 T A 7: 19,835,360 (GRCm39) F93Y probably benign Het
Vmn2r77 T A 7: 86,450,878 (GRCm39) Y255N probably benign Het
Vmn2r96 A T 17: 18,804,221 (GRCm39) Q490H probably benign Het
Vwa2 A G 19: 56,891,897 (GRCm39) probably null Het
Vwf A G 6: 125,634,028 (GRCm39) K169E unknown Het
Zc3h7b G C 15: 81,662,911 (GRCm39) probably null Het
Zfp458 T A 13: 67,405,662 (GRCm39) H259L possibly damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp804b A G 5: 6,819,910 (GRCm39) V1051A probably benign Het
Zfp998 A T 13: 66,579,740 (GRCm39) C248S probably damaging Het
Other mutations in Traip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Traip APN 9 107,847,749 (GRCm39) missense probably benign 0.15
IGL01457:Traip APN 9 107,847,671 (GRCm39) missense probably benign 0.00
IGL01597:Traip APN 9 107,833,123 (GRCm39) critical splice donor site probably null
IGL02197:Traip APN 9 107,845,936 (GRCm39) missense possibly damaging 0.89
IGL03077:Traip APN 9 107,840,125 (GRCm39) unclassified probably benign
IGL03226:Traip APN 9 107,848,192 (GRCm39) missense probably damaging 0.97
BB008:Traip UTSW 9 107,848,241 (GRCm39) missense probably benign 0.04
BB018:Traip UTSW 9 107,848,241 (GRCm39) missense probably benign 0.04
P0016:Traip UTSW 9 107,845,855 (GRCm39) missense possibly damaging 0.93
R1693:Traip UTSW 9 107,847,229 (GRCm39) missense probably damaging 0.99
R2054:Traip UTSW 9 107,840,118 (GRCm39) missense probably benign 0.08
R4396:Traip UTSW 9 107,836,686 (GRCm39) missense probably benign 0.02
R4617:Traip UTSW 9 107,847,218 (GRCm39) missense probably benign 0.00
R6241:Traip UTSW 9 107,845,933 (GRCm39) missense probably benign 0.33
R6920:Traip UTSW 9 107,838,240 (GRCm39) nonsense probably null
R7177:Traip UTSW 9 107,838,184 (GRCm39) missense possibly damaging 0.62
R7191:Traip UTSW 9 107,847,216 (GRCm39) missense probably benign
R7504:Traip UTSW 9 107,838,743 (GRCm39) missense probably benign 0.05
R7931:Traip UTSW 9 107,848,241 (GRCm39) missense probably benign 0.04
R7939:Traip UTSW 9 107,833,077 (GRCm39) missense probably benign 0.21
R8228:Traip UTSW 9 107,838,265 (GRCm39) missense probably benign 0.16
R9059:Traip UTSW 9 107,840,549 (GRCm39) missense probably benign 0.01
R9511:Traip UTSW 9 107,838,785 (GRCm39) missense probably damaging 1.00
R9548:Traip UTSW 9 107,833,099 (GRCm39) missense probably damaging 1.00
X0018:Traip UTSW 9 107,838,855 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTGGCATTATTCCAACAGGAG -3'
(R):5'- TAGGCTGTAGGCACTGGAAG -3'

Sequencing Primer
(F):5'- TTATTCCAACAGGAGTCCCAGCTC -3'
(R):5'- GCATATGCCCCTAAGGTCATCTCAG -3'
Posted On 2017-10-10