Mutagenetix > Incidental Mutation

Incidental Mutation 'R6151:Tenm2'

489274

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

044298-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.608) question?

Stock #

R6151 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 36008783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 2516 (V2516G)

Ref Sequence

ENSEMBL: ENSMUSP00000129951 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057207
AA Change: V2517G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: V2517G

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102801
AA Change: V2516G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: V2516G

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163524
AA Change: V2516G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: V2516G

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	T	13: 66,431,681	C248S	probably damaging	Het
3110009E18Rik	A	G	1: 120,171,486		probably null	Het
4930550C14Rik	G	T	9: 53,414,383	R73S	probably damaging	Het
Abca1	A	G	4: 53,085,261	V517A	probably benign	Het
Adck5	A	T	15: 76,594,687	K370N	possibly damaging	Het
Akap6	A	C	12: 53,025,792	D981A	probably damaging	Het
Apbb1	G	A	7: 105,574,252	R51*	probably null	Het
Arhgap23	A	G	11: 97,500,412	M1252V	probably benign	Het
Arhgef1	A	G	7: 24,917,942	T354A	probably benign	Het
Arid1a	G	T	4: 133,684,976	Q1636K	unknown	Het
Asmt	C	T	X: 170,676,467	A237V	possibly damaging	Het
Brat1	T	A	5: 140,705,961	C43S	probably benign	Het
Cd36	T	C	5: 17,795,595	Y370C	probably damaging	Het
Ceacam12	A	T	7: 18,069,105	L145F	probably benign	Het
Col24a1	C	T	3: 145,314,054	T62I	probably damaging	Het
Col6a3	G	T	1: 90,813,753	N652K	possibly damaging	Het
Dcbld1	T	C	10: 52,304,660	L140P	probably damaging	Het
Dhrs13	G	A	11: 78,036,982	C218Y	probably damaging	Het
Diaph1	T	G	18: 37,853,353	E1158A	probably damaging	Het
Emp2	A	C	16: 10,292,281	F20C	probably damaging	Het
Enpep	T	C	3: 129,332,418	I22V	possibly damaging	Het
Epha2	A	G	4: 141,318,480		probably null	Het
Eprs	G	T	1: 185,407,754		probably null	Het
Etl4	T	A	2: 20,713,360	I304N	probably damaging	Het
Exoc3l2	C	A	7: 19,491,745	S89*	probably null	Het
F5	A	T	1: 164,181,635	I325F	probably damaging	Het
F5	G	A	1: 164,190,187	C611Y	probably damaging	Het
Fam133b	A	T	5: 3,559,133	S116C	probably null	Het
Fam13b	A	T	18: 34,494,277	D190E	probably damaging	Het
Fam169a	T	G	13: 97,093,630	Y58D	probably damaging	Het
Far1	G	A	7: 113,561,396	R383H	possibly damaging	Het
Fnbp1l	T	C	3: 122,570,930	K52R	possibly damaging	Het
Foxj3	C	A	4: 119,623,271	Q469K	unknown	Het
Frs3	A	T	17: 47,689,088		probably benign	Het
Gdpd3	A	G	7: 126,775,502	S290G	probably benign	Het
Gm6768	T	G	12: 119,261,106		noncoding transcript	Het
Gmip	T	A	8: 69,817,085	L610Q	probably damaging	Het
Gprc5c	T	A	11: 114,864,025	I176N	probably damaging	Het
Grm3	A	G	5: 9,511,556	F765L	probably damaging	Het
Hhat	A	T	1: 192,759,757	L2Q	probably damaging	Het
Hrasls5	C	T	19: 7,619,291	P148S	probably damaging	Het
Hspbap1	T	C	16: 35,817,222	S214P	probably damaging	Het
Ighv1-62-3	C	A	12: 115,461,289	V21F	probably damaging	Het
Kcnj15	A	T	16: 95,295,668	K50*	probably null	Het
Kidins220	T	C	12: 25,056,909	S1454P	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Klhl23	T	G	2: 69,824,854	L356R	probably damaging	Het
Kndc1	A	T	7: 139,921,213	D806V	probably benign	Het
Krt26	T	C	11: 99,337,489	E139G	probably benign	Het
Lefty1	T	C	1: 180,935,116	F3L	unknown	Het
Madd	A	C	2: 91,165,457	Y853*	probably null	Het
Map1a	T	A	2: 121,289,823	D63E	probably benign	Het
Mdn1	T	A	4: 32,684,735	V815E	probably damaging	Het
Mettl3	A	G	14: 52,295,020	Y569H	probably damaging	Het
Mknk2	T	C	10: 80,669,025		probably null	Het
Mpp3	C	A	11: 102,008,566	R376S	probably benign	Het
Nup160	T	A	2: 90,690,105	Y293*	probably null	Het
Nupl1	A	T	14: 60,244,616	F100I	possibly damaging	Het
Nxpe2	A	C	9: 48,326,191	L255V	probably benign	Het
Olfr1423	T	C	19: 12,036,736	E2G	probably benign	Het
Olfr167	A	T	16: 19,515,531	L35Q	probably damaging	Het
Olfr390	T	A	11: 73,787,695	Y252*	probably null	Het
Olfr479	A	G	7: 108,055,899	I306V	probably benign	Het
Padi3	A	T	4: 140,796,394	D248E	probably damaging	Het
Paxip1	G	T	5: 27,761,618	H637N	probably damaging	Het
Pde4b	T	A	4: 102,601,551	M296K	probably damaging	Het
Pkd1	A	G	17: 24,575,606	H2089R	probably benign	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rhebl1	T	C	15: 98,878,279	I165V	probably benign	Het
Rock1	A	T	18: 10,106,426	V481E	possibly damaging	Het
Rtca	T	A	3: 116,507,827	T24S	probably benign	Het
Serpina3c	T	A	12: 104,152,068	I4F	possibly damaging	Het
Serpina3j	C	A	12: 104,317,390	A249E	possibly damaging	Het
Slc38a9	A	G	13: 112,689,376	N116S	probably damaging	Het
Slco2b1	C	T	7: 99,690,563	V58I	possibly damaging	Het
Slfn8	T	A	11: 83,017,321	Y132F	probably damaging	Het
Smg6	T	G	11: 75,156,207	I1242S	probably damaging	Het
Tap2	G	T	17: 34,212,047	V374L	probably benign	Het
Tbc1d10b	G	A	7: 127,207,996	T123M	probably damaging	Het
Tenm3	C	T	8: 48,395,573	R12Q	probably damaging	Het
Tmem130	T	A	5: 144,737,851	M355L	probably benign	Het
Tns4	C	T	11: 99,075,550	S433N	probably benign	Het
Traip	G	T	9: 107,970,619		probably null	Het
Trmo	G	A	4: 46,389,390	R2C	probably damaging	Het
Ttn	A	T	2: 76,944,160	I2134N	probably damaging	Het
Uba1y	A	G	Y: 825,984	D380G	probably benign	Het
Ube2t	T	A	1: 134,967,960		probably null	Het
Ugdh	A	T	5: 65,417,581	Y367*	probably null	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vmn1r84	G	T	7: 12,361,914	T284K	possibly damaging	Het
Vmn1r91	T	A	7: 20,101,435	F93Y	probably benign	Het
Vmn2r77	T	A	7: 86,801,670	Y255N	probably benign	Het
Vmn2r96	A	T	17: 18,583,959	Q490H	probably benign	Het
Vwa2	A	G	19: 56,903,465		probably null	Het
Vwf	A	G	6: 125,657,065	K169E	unknown	Het
Zc3h7b	G	C	15: 81,778,710		probably null	Het
Zfp458	T	A	13: 67,257,598	H259L	possibly damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp804b	A	G	5: 6,769,910	V1051A	probably benign	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AACACGGATGCTACCTTGCG -3'
(R):5'- ACCCCATTAGAGGACTGGGAAC -3'

Sequencing Primer
(F):5'- TCACTGGCGATGCTAGACACTC -3'
(R):5'- GGAACCAGCCCGTCTGC -3'

Posted On

2017-10-10