Mutagenetix > Incidental Mutation

Incidental Mutation 'R6151:Kidins220'

489284

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

044298-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6151 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24974925-25063152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25056909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1454 (S1454P)

Ref Sequence

ENSEMBL: ENSMUSP00000152683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]

AlphaFold

E9Q9B7

Predicted Effect

probably benign
Transcript: ENSMUST00000066652
AA Change: S1484P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: S1484P

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220459
AA Change: S1363P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221622

Predicted Effect

probably benign
Transcript: ENSMUST00000222013

Predicted Effect

probably benign
Transcript: ENSMUST00000222481

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222941
AA Change: S1454P

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	T	13: 66,431,681	C248S	probably damaging	Het
3110009E18Rik	A	G	1: 120,171,486		probably null	Het
4930550C14Rik	G	T	9: 53,414,383	R73S	probably damaging	Het
Abca1	A	G	4: 53,085,261	V517A	probably benign	Het
Adck5	A	T	15: 76,594,687	K370N	possibly damaging	Het
Akap6	A	C	12: 53,025,792	D981A	probably damaging	Het
Apbb1	G	A	7: 105,574,252	R51*	probably null	Het
Arhgap23	A	G	11: 97,500,412	M1252V	probably benign	Het
Arhgef1	A	G	7: 24,917,942	T354A	probably benign	Het
Arid1a	G	T	4: 133,684,976	Q1636K	unknown	Het
Asmt	C	T	X: 170,676,467	A237V	possibly damaging	Het
Brat1	T	A	5: 140,705,961	C43S	probably benign	Het
Cd36	T	C	5: 17,795,595	Y370C	probably damaging	Het
Ceacam12	A	T	7: 18,069,105	L145F	probably benign	Het
Col24a1	C	T	3: 145,314,054	T62I	probably damaging	Het
Col6a3	G	T	1: 90,813,753	N652K	possibly damaging	Het
Dcbld1	T	C	10: 52,304,660	L140P	probably damaging	Het
Dhrs13	G	A	11: 78,036,982	C218Y	probably damaging	Het
Diaph1	T	G	18: 37,853,353	E1158A	probably damaging	Het
Emp2	A	C	16: 10,292,281	F20C	probably damaging	Het
Enpep	T	C	3: 129,332,418	I22V	possibly damaging	Het
Epha2	A	G	4: 141,318,480		probably null	Het
Eprs	G	T	1: 185,407,754		probably null	Het
Etl4	T	A	2: 20,713,360	I304N	probably damaging	Het
Exoc3l2	C	A	7: 19,491,745	S89*	probably null	Het
F5	A	T	1: 164,181,635	I325F	probably damaging	Het
F5	G	A	1: 164,190,187	C611Y	probably damaging	Het
Fam133b	A	T	5: 3,559,133	S116C	probably null	Het
Fam13b	A	T	18: 34,494,277	D190E	probably damaging	Het
Fam169a	T	G	13: 97,093,630	Y58D	probably damaging	Het
Far1	G	A	7: 113,561,396	R383H	possibly damaging	Het
Fnbp1l	T	C	3: 122,570,930	K52R	possibly damaging	Het
Foxj3	C	A	4: 119,623,271	Q469K	unknown	Het
Frs3	A	T	17: 47,689,088		probably benign	Het
Gdpd3	A	G	7: 126,775,502	S290G	probably benign	Het
Gm6768	T	G	12: 119,261,106		noncoding transcript	Het
Gmip	T	A	8: 69,817,085	L610Q	probably damaging	Het
Gprc5c	T	A	11: 114,864,025	I176N	probably damaging	Het
Grm3	A	G	5: 9,511,556	F765L	probably damaging	Het
Hhat	A	T	1: 192,759,757	L2Q	probably damaging	Het
Hrasls5	C	T	19: 7,619,291	P148S	probably damaging	Het
Hspbap1	T	C	16: 35,817,222	S214P	probably damaging	Het
Ighv1-62-3	C	A	12: 115,461,289	V21F	probably damaging	Het
Kcnj15	A	T	16: 95,295,668	K50*	probably null	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Klhl23	T	G	2: 69,824,854	L356R	probably damaging	Het
Kndc1	A	T	7: 139,921,213	D806V	probably benign	Het
Krt26	T	C	11: 99,337,489	E139G	probably benign	Het
Lefty1	T	C	1: 180,935,116	F3L	unknown	Het
Madd	A	C	2: 91,165,457	Y853*	probably null	Het
Map1a	T	A	2: 121,289,823	D63E	probably benign	Het
Mdn1	T	A	4: 32,684,735	V815E	probably damaging	Het
Mettl3	A	G	14: 52,295,020	Y569H	probably damaging	Het
Mknk2	T	C	10: 80,669,025		probably null	Het
Mpp3	C	A	11: 102,008,566	R376S	probably benign	Het
Nup160	T	A	2: 90,690,105	Y293*	probably null	Het
Nupl1	A	T	14: 60,244,616	F100I	possibly damaging	Het
Nxpe2	A	C	9: 48,326,191	L255V	probably benign	Het
Olfr1423	T	C	19: 12,036,736	E2G	probably benign	Het
Olfr167	A	T	16: 19,515,531	L35Q	probably damaging	Het
Olfr390	T	A	11: 73,787,695	Y252*	probably null	Het
Olfr479	A	G	7: 108,055,899	I306V	probably benign	Het
Padi3	A	T	4: 140,796,394	D248E	probably damaging	Het
Paxip1	G	T	5: 27,761,618	H637N	probably damaging	Het
Pde4b	T	A	4: 102,601,551	M296K	probably damaging	Het
Pkd1	A	G	17: 24,575,606	H2089R	probably benign	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rhebl1	T	C	15: 98,878,279	I165V	probably benign	Het
Rock1	A	T	18: 10,106,426	V481E	possibly damaging	Het
Rtca	T	A	3: 116,507,827	T24S	probably benign	Het
Serpina3c	T	A	12: 104,152,068	I4F	possibly damaging	Het
Serpina3j	C	A	12: 104,317,390	A249E	possibly damaging	Het
Slc38a9	A	G	13: 112,689,376	N116S	probably damaging	Het
Slco2b1	C	T	7: 99,690,563	V58I	possibly damaging	Het
Slfn8	T	A	11: 83,017,321	Y132F	probably damaging	Het
Smg6	T	G	11: 75,156,207	I1242S	probably damaging	Het
Tap2	G	T	17: 34,212,047	V374L	probably benign	Het
Tbc1d10b	G	A	7: 127,207,996	T123M	probably damaging	Het
Tenm2	A	C	11: 36,008,783	V2516G	probably damaging	Het
Tenm3	C	T	8: 48,395,573	R12Q	probably damaging	Het
Tmem130	T	A	5: 144,737,851	M355L	probably benign	Het
Tns4	C	T	11: 99,075,550	S433N	probably benign	Het
Traip	G	T	9: 107,970,619		probably null	Het
Trmo	G	A	4: 46,389,390	R2C	probably damaging	Het
Ttn	A	T	2: 76,944,160	I2134N	probably damaging	Het
Uba1y	A	G	Y: 825,984	D380G	probably benign	Het
Ube2t	T	A	1: 134,967,960		probably null	Het
Ugdh	A	T	5: 65,417,581	Y367*	probably null	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vmn1r84	G	T	7: 12,361,914	T284K	possibly damaging	Het
Vmn1r91	T	A	7: 20,101,435	F93Y	probably benign	Het
Vmn2r77	T	A	7: 86,801,670	Y255N	probably benign	Het
Vmn2r96	A	T	17: 18,583,959	Q490H	probably benign	Het
Vwa2	A	G	19: 56,903,465		probably null	Het
Vwf	A	G	6: 125,657,065	K169E	unknown	Het
Zc3h7b	G	C	15: 81,778,710		probably null	Het
Zfp458	T	A	13: 67,257,598	H259L	possibly damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp804b	A	G	5: 6,769,910	V1051A	probably benign	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25038560	splice site	probably benign
IGL00959:Kidins220	APN	12	25051133	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25057474	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25010926	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25038499	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25040460	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	24995000	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25057729	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25004111	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	24997333	splice site	probably benign
IGL02673:Kidins220	APN	12	24994992	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25003093	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25003045	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25008448	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	24999345	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25008156	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25040512	missense	probably damaging	0.98
R0280:Kidins220	UTSW	12	25010141	missense	probably damaging	1.00
R0334:Kidins220	UTSW	12	25008069	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25005088	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25013446	splice site	probably benign
R1808:Kidins220	UTSW	12	25003009	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25056591	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	24994906	missense	probably damaging	1.00
R1982:Kidins220	UTSW	12	25051194	missense	probably benign	0.01
R2069:Kidins220	UTSW	12	24987006	splice site	probably benign
R2101:Kidins220	UTSW	12	25057423	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25041303	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25057324	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25011509	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	24990758	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25001565	splice site	probably benign
R3915:Kidins220	UTSW	12	25053958	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25057144	splice site	probably null
R4287:Kidins220	UTSW	12	25056846	missense	possibly damaging	0.81
R4476:Kidins220	UTSW	12	25011001	missense	probably damaging	1.00
R4495:Kidins220	UTSW	12	25038302	splice site	probably null
R4627:Kidins220	UTSW	12	25057042	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25057285	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25013443	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	24992260	nonsense	probably null
R5118:Kidins220	UTSW	12	24992297	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25051126	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25003010	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25047897	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25013391	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25057140	nonsense	probably null
R6131:Kidins220	UTSW	12	24992314	splice site	probably null
R6146:Kidins220	UTSW	12	25052813	missense	probably damaging	1.00
R6160:Kidins220	UTSW	12	24997311	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25051308	splice site	probably null
R6289:Kidins220	UTSW	12	25056616	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25057534	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25057191	missense	probably benign
R6513:Kidins220	UTSW	12	25038435	missense	possibly damaging	0.94
R6652:Kidins220	UTSW	12	25010060	splice site	probably null
R6711:Kidins220	UTSW	12	24998751	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25008543	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25057663	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25004019	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	24994821	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25036624	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25011571	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25057000	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	24982361	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	24992269	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	24988556	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	24982351	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25061231	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25057716	missense	probably benign	0.29
R8214:Kidins220	UTSW	12	24994855	missense	probably damaging	1.00
R8304:Kidins220	UTSW	12	25057128	missense	probably benign	0.01
R8313:Kidins220	UTSW	12	25004111	missense	probably damaging	1.00
R8346:Kidins220	UTSW	12	25036534	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	24990728	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25040528	missense	probably benign	0.00
R8722:Kidins220	UTSW	12	25001594	missense	probably benign
R8831:Kidins220	UTSW	12	25036455	missense	possibly damaging	0.70
R8960:Kidins220	UTSW	12	25056915	missense	probably benign	0.05
R9193:Kidins220	UTSW	12	24986967	missense	possibly damaging	0.79
R9267:Kidins220	UTSW	12	24988559	missense	probably benign	0.29
R9303:Kidins220	UTSW	12	25057111	missense	probably benign	0.36
R9343:Kidins220	UTSW	12	25008079	missense	probably damaging	1.00
R9526:Kidins220	UTSW	12	25038384	missense	probably damaging	1.00
R9644:Kidins220	UTSW	12	25011019	missense	probably damaging	1.00
R9655:Kidins220	UTSW	12	24997296	missense	probably damaging	1.00
R9664:Kidins220	UTSW	12	25056896	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GGGTCGTCAACAATAAGCGG -3'
(R):5'- GGGGTATTATCTGACTCTTCTGTCC -3'

Sequencing Primer
(F):5'- ATAAGCGGCAGATCTTCTCC -3'
(R):5'- AGACTCATCTTCATCACTGGGCAG -3'

Posted On

2017-10-10