Mutagenetix > Incidental Mutations

Incidental Mutation 'R6151:Akap6'

489285

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

044298-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.755) question?

Stock #

R6151 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53025792 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 981 (D981A)

Ref Sequence

ENSEMBL: ENSMUSP00000151871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

Predicted Effect

probably damaging
Transcript: ENSMUST00000095737
AA Change: D981A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: D981A

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000219786
AA Change: D981A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	T	13: 66,431,681	C248S	probably damaging	Het
3110009E18Rik	A	G	1: 120,171,486		probably null	Het
4930550C14Rik	G	T	9: 53,414,383	R73S	probably damaging	Het
Abca1	A	G	4: 53,085,261	V517A	probably benign	Het
Adck5	A	T	15: 76,594,687	K370N	possibly damaging	Het
Apbb1	G	A	7: 105,574,252	R51*	probably null	Het
Arhgap23	A	G	11: 97,500,412	M1252V	probably benign	Het
Arhgef1	A	G	7: 24,917,942	T354A	probably benign	Het
Arid1a	G	T	4: 133,684,976	Q1636K	unknown	Het
Asmt	C	T	X: 170,676,467	A237V	possibly damaging	Het
Brat1	T	A	5: 140,705,961	C43S	probably benign	Het
Cd36	T	C	5: 17,795,595	Y370C	probably damaging	Het
Ceacam12	A	T	7: 18,069,105	L145F	probably benign	Het
Col24a1	C	T	3: 145,314,054	T62I	probably damaging	Het
Col6a3	G	T	1: 90,813,753	N652K	possibly damaging	Het
Dcbld1	T	C	10: 52,304,660	L140P	probably damaging	Het
Dhrs13	G	A	11: 78,036,982	C218Y	probably damaging	Het
Diaph1	T	G	18: 37,853,353	E1158A	probably damaging	Het
Emp2	A	C	16: 10,292,281	F20C	probably damaging	Het
Enpep	T	C	3: 129,332,418	I22V	possibly damaging	Het
Epha2	A	G	4: 141,318,480		probably null	Het
Eprs	G	T	1: 185,407,754		probably null	Het
Etl4	T	A	2: 20,713,360	I304N	probably damaging	Het
Exoc3l2	C	A	7: 19,491,745	S89*	probably null	Het
F5	A	T	1: 164,181,635	I325F	probably damaging	Het
F5	G	A	1: 164,190,187	C611Y	probably damaging	Het
Fam133b	A	T	5: 3,559,133	S116C	probably null	Het
Fam13b	A	T	18: 34,494,277	D190E	probably damaging	Het
Fam169a	T	G	13: 97,093,630	Y58D	probably damaging	Het
Far1	G	A	7: 113,561,396	R383H	possibly damaging	Het
Fnbp1l	T	C	3: 122,570,930	K52R	possibly damaging	Het
Foxj3	C	A	4: 119,623,271	Q469K	unknown	Het
Frs3	A	T	17: 47,689,088		probably benign	Het
Gdpd3	A	G	7: 126,775,502	S290G	probably benign	Het
Gm6768	T	G	12: 119,261,106		noncoding transcript	Het
Gmip	T	A	8: 69,817,085	L610Q	probably damaging	Het
Gprc5c	T	A	11: 114,864,025	I176N	probably damaging	Het
Grm3	A	G	5: 9,511,556	F765L	probably damaging	Het
Hhat	A	T	1: 192,759,757	L2Q	probably damaging	Het
Hrasls5	C	T	19: 7,619,291	P148S	probably damaging	Het
Hspbap1	T	C	16: 35,817,222	S214P	probably damaging	Het
Ighv1-62-3	C	A	12: 115,461,289	V21F	probably damaging	Het
Kcnj15	A	T	16: 95,295,668	K50*	probably null	Het
Kidins220	T	C	12: 25,056,909	S1454P	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Klhl23	T	G	2: 69,824,854	L356R	probably damaging	Het
Kndc1	A	T	7: 139,921,213	D806V	probably benign	Het
Krt26	T	C	11: 99,337,489	E139G	probably benign	Het
Lefty1	T	C	1: 180,935,116	F3L	unknown	Het
Madd	A	C	2: 91,165,457	Y853*	probably null	Het
Map1a	T	A	2: 121,289,823	D63E	probably benign	Het
Mdn1	T	A	4: 32,684,735	V815E	probably damaging	Het
Mettl3	A	G	14: 52,295,020	Y569H	probably damaging	Het
Mknk2	T	C	10: 80,669,025		probably null	Het
Mpp3	C	A	11: 102,008,566	R376S	probably benign	Het
Nup160	T	A	2: 90,690,105	Y293*	probably null	Het
Nupl1	A	T	14: 60,244,616	F100I	possibly damaging	Het
Nxpe2	A	C	9: 48,326,191	L255V	probably benign	Het
Olfr1423	T	C	19: 12,036,736	E2G	probably benign	Het
Olfr167	A	T	16: 19,515,531	L35Q	probably damaging	Het
Olfr390	T	A	11: 73,787,695	Y252*	probably null	Het
Olfr479	A	G	7: 108,055,899	I306V	probably benign	Het
Padi3	A	T	4: 140,796,394	D248E	probably damaging	Het
Paxip1	G	T	5: 27,761,618	H637N	probably damaging	Het
Pde4b	T	A	4: 102,601,551	M296K	probably damaging	Het
Pkd1	A	G	17: 24,575,606	H2089R	probably benign	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rhebl1	T	C	15: 98,878,279	I165V	probably benign	Het
Rock1	A	T	18: 10,106,426	V481E	possibly damaging	Het
Rtca	T	A	3: 116,507,827	T24S	probably benign	Het
Serpina3c	T	A	12: 104,152,068	I4F	possibly damaging	Het
Serpina3j	C	A	12: 104,317,390	A249E	possibly damaging	Het
Slc38a9	A	G	13: 112,689,376	N116S	probably damaging	Het
Slco2b1	C	T	7: 99,690,563	V58I	possibly damaging	Het
Slfn8	T	A	11: 83,017,321	Y132F	probably damaging	Het
Smg6	T	G	11: 75,156,207	I1242S	probably damaging	Het
Tap2	G	T	17: 34,212,047	V374L	probably benign	Het
Tbc1d10b	G	A	7: 127,207,996	T123M	probably damaging	Het
Tenm2	A	C	11: 36,008,783	V2516G	probably damaging	Het
Tenm3	C	T	8: 48,395,573	R12Q	probably damaging	Het
Tmem130	T	A	5: 144,737,851	M355L	probably benign	Het
Tns4	C	T	11: 99,075,550	S433N	probably benign	Het
Traip	G	T	9: 107,970,619		probably null	Het
Trmo	G	A	4: 46,389,390	R2C	probably damaging	Het
Ttn	A	T	2: 76,944,160	I2134N	probably damaging	Het
Uba1y	A	G	Y: 825,984	D380G	probably benign	Het
Ube2t	T	A	1: 134,967,960		probably null	Het
Ugdh	A	T	5: 65,417,581	Y367*	probably null	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vmn1r84	G	T	7: 12,361,914	T284K	possibly damaging	Het
Vmn1r91	T	A	7: 20,101,435	F93Y	probably benign	Het
Vmn2r77	T	A	7: 86,801,670	Y255N	probably benign	Het
Vmn2r96	A	T	17: 18,583,959	Q490H	probably benign	Het
Vwa2	A	G	19: 56,903,465		probably null	Het
Vwf	A	G	6: 125,657,065	K169E	unknown	Het
Zc3h7b	G	C	15: 81,778,710		probably null	Het
Zfp458	T	A	13: 67,257,598	H259L	possibly damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp804b	A	G	5: 6,769,910	V1051A	probably benign	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AGGAACACCCTGGGTTCTCAAG -3'
(R):5'- AATTATGATGTCGGTGCGGCC -3'

Sequencing Primer
(F):5'- CTTCAGGCTTCTGGACTT -3'
(R):5'- CCTGTCAGCACACTAGGGAG -3'

Posted On

2017-10-10