Incidental Mutation 'R6151:Olfr167'
ID489301
Institutional Source Beutler Lab
Gene Symbol Olfr167
Ensembl Gene ENSMUSG00000045341
Gene Nameolfactory receptor 167
SynonymsMOR272-1, GA_x54KRFPKG5P-15963726-15962788
MMRRC Submission 044298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6151 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location19509558-19522266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19515531 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 35 (L35Q)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
Predicted Effect probably damaging
Transcript: ENSMUST00000054606
AA Change: L35Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: L35Q

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214315
AA Change: L35Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217566
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Olfr167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Olfr167 APN 16 19515478 missense probably benign 0.01
IGL02115:Olfr167 APN 16 19515103 missense probably damaging 1.00
IGL02562:Olfr167 APN 16 19514964 missense possibly damaging 0.74
BB008:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
BB018:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R0366:Olfr167 UTSW 16 19514848 missense probably benign 0.13
R0673:Olfr167 UTSW 16 19515396 missense probably damaging 1.00
R1187:Olfr167 UTSW 16 19515046 missense probably benign 0.01
R1237:Olfr167 UTSW 16 19515625 missense probably benign 0.01
R1975:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1977:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1997:Olfr167 UTSW 16 19515042 missense probably damaging 1.00
R2225:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R2226:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R4078:Olfr167 UTSW 16 19515232 missense possibly damaging 0.76
R5019:Olfr167 UTSW 16 19515535 missense probably damaging 0.99
R5071:Olfr167 UTSW 16 19515027 missense probably benign 0.00
R5278:Olfr167 UTSW 16 19515378 nonsense probably null
R5415:Olfr167 UTSW 16 19515246 missense possibly damaging 0.94
R5744:Olfr167 UTSW 16 19515336 missense probably benign 0.00
R5991:Olfr167 UTSW 16 19514757 missense probably damaging 0.99
R6540:Olfr167 UTSW 16 19514821 missense probably benign
R7014:Olfr167 UTSW 16 19515456 missense probably benign 0.20
R7145:Olfr167 UTSW 16 19514899 missense probably damaging 0.99
R7535:Olfr167 UTSW 16 19514794 missense probably damaging 1.00
R7677:Olfr167 UTSW 16 19514928 missense probably benign 0.42
R7715:Olfr167 UTSW 16 19514730 missense probably benign 0.00
R7931:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R8137:Olfr167 UTSW 16 19515096 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAACAAAAGGGTTTCTGCACC -3'
(R):5'- GCAGTTATGATTATTCTCAGTCTGG -3'

Sequencing Primer
(F):5'- GGTTTCTGCACCCCCAAAAGTC -3'
(R):5'- CTCAGTCTGGTGAAAATCATGAATTG -3'
Posted On2017-10-10