Incidental Mutation 'R6151:Tap2'
ID489306
Institutional Source Beutler Lab
Gene Symbol Tap2
Ensembl Gene ENSMUSG00000024339
Gene Nametransporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
SynonymsAbcb3, Ham-2, HAM2, Ham2, MTP2, PSF2, Tap-2
MMRRC Submission 044298-MU
Accession Numbers

Genbank: NM_011530; MGI: 98484

Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6151 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34203527-34216321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34212047 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 374 (V374L)
Ref Sequence ENSEMBL: ENSMUSP00000025197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025197] [ENSMUST00000121995] [ENSMUST00000121995] [ENSMUST00000121995] [ENSMUST00000121995]
Predicted Effect probably benign
Transcript: ENSMUST00000025197
AA Change: V374L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339
AA Change: V374L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121995
SMART Domains Protein: ENSMUSP00000112395
Gene: ENSMUSG00000081512

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121995
SMART Domains Protein: ENSMUSP00000112395
Gene: ENSMUSG00000081512

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121995
SMART Domains Protein: ENSMUSP00000112395
Gene: ENSMUSG00000081512

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121995
SMART Domains Protein: ENSMUSP00000112395
Gene: ENSMUSG00000081512

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145528
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with Tap1 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have no CD8+ T cells, although their numbers of CD4+ T cells and B cells are normal. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Chemically induced(1)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Tap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tap2 APN 17 34215378 missense probably benign 0.09
IGL00802:Tap2 APN 17 34209130 missense probably damaging 0.96
IGL01291:Tap2 APN 17 34209210 missense probably benign 0.01
IGL01337:Tap2 APN 17 34205412 unclassified probably benign
IGL01549:Tap2 APN 17 34214329 missense probably benign 0.12
IGL02433:Tap2 APN 17 34205419 unclassified probably benign
IGL02488:Tap2 APN 17 34214642 unclassified probably benign
IGL02657:Tap2 APN 17 34205458 missense probably damaging 0.99
IGL02677:Tap2 APN 17 34212047 missense probably benign 0.20
IGL03183:Tap2 APN 17 34205425 unclassified probably benign
date UTSW 17 34212354 missense probably damaging 0.99
date2 UTSW 17 34214032 nonsense probably null
ganymede UTSW 17 small insertion
hebe UTSW 17 small insertion
juventas UTSW 17 small insertion
Palm UTSW 17 34215940 missense possibly damaging 0.64
3370:Tap2 UTSW 17 34209279 splice site probably null
ANU05:Tap2 UTSW 17 34209210 missense probably benign 0.01
FR4976:Tap2 UTSW 17 34205699 unclassified probably benign
R0595:Tap2 UTSW 17 34212354 missense probably damaging 0.99
R0841:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1296:Tap2 UTSW 17 34211915 missense probably benign 0.12
R1567:Tap2 UTSW 17 34214091 missense probably benign 0.00
R1656:Tap2 UTSW 17 34205953 missense possibly damaging 0.64
R1693:Tap2 UTSW 17 34209212 missense probably benign 0.00
R2246:Tap2 UTSW 17 34208801 missense possibly damaging 0.82
R2251:Tap2 UTSW 17 34211954 missense probably damaging 0.98
R2937:Tap2 UTSW 17 34212354 missense possibly damaging 0.80
R4682:Tap2 UTSW 17 34214032 nonsense probably null
R5262:Tap2 UTSW 17 34214016 missense probably benign
R6052:Tap2 UTSW 17 34214709 missense probably damaging 1.00
R6196:Tap2 UTSW 17 34214410 missense possibly damaging 0.50
R7020:Tap2 UTSW 17 34214414 missense possibly damaging 0.78
R7677:Tap2 UTSW 17 34205520 missense probably benign 0.01
R7694:Tap2 UTSW 17 34205697 missense probably benign
R8129:Tap2 UTSW 17 34205698 missense probably benign 0.01
R8256:Tap2 UTSW 17 34216032 missense probably benign 0.04
Z1177:Tap2 UTSW 17 34205668 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTCAGGCGGTGCTAAAGG -3'
(R):5'- CAGAATCAGCACCTGCATGC -3'

Sequencing Primer
(F):5'- TTTCAGGCGGTGCTAAAGGAGATC -3'
(R):5'- GCACCTGCATGCCCAAG -3'
Posted On2017-10-10