Incidental Mutation 'R6151:Asmt'
ID489314
Institutional Source Beutler Lab
Gene Symbol Asmt
Ensembl Gene ENSMUSG00000093806
Gene Nameacetylserotonin O-methyltransferase
SynonymsHiomt
MMRRC Submission 044298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6151 (G1)
Quality Score84.0076
Status Not validated
ChromosomeX
Chromosomal Location170672644-170678054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 170676467 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 237 (A237V)
Ref Sequence ENSEMBL: ENSMUSP00000137135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178693]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178693
AA Change: A237V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137135
Gene: ENSMUSG00000093806
AA Change: A237V

DomainStartEndE-ValueType
Pfam:Dimerisation2 17 106 1.1e-29 PFAM
Pfam:Methyltransf_2 111 343 2.8e-82 PFAM
Pfam:Methyltransf_11 190 292 2.8e-8 PFAM
low complexity region 351 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the methyltransferase superfamily and is located in the pseudoautosomal region (PAR) of the X and Y chromosomes. The encoded enzyme catalyzes the final reaction in the synthesis of melatonin and is abundant in the pineal gland. Two amino acid substitutions (R78G and R242C) are present in the encoded protein derived from the reference strain, C57BL/6J, and this protein shows low enzyme activity relative to the protein derived from other strains. [provided by RefSeq, May 2015]
PHENOTYPE: Pineal melatonin synthesis requires enzymes encoded by Asmt and Aanat. C57BL/6, BALB/c, AKR/J, NZB/Bl, IS/Cam, and CAST/Ei carry the a allele of Asmt and lack melatonin. SK/Cam, SF/Cam, PERU, and FDS carry the b allele and have normal melatonin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Asmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1634:Asmt UTSW X 170675829 missense probably damaging 1.00
R1809:Asmt UTSW X 170675745 splice site probably benign
R1994:Asmt UTSW X 170675789 missense possibly damaging 0.83
R4454:Asmt UTSW X 170672721 missense probably benign 0.01
R4546:Asmt UTSW X 170676495 critical splice donor site probably null
R4567:Asmt UTSW X 170676526 intron probably null
R4889:Asmt UTSW X 170677029 missense possibly damaging 0.84
R5601:Asmt UTSW X 170676392 missense probably damaging 0.98
R5687:Asmt UTSW X 170678016 missense unknown
R6145:Asmt UTSW X 170674663 missense probably damaging 0.96
R6582:Asmt UTSW X 170675031 critical splice donor site probably null
R6752:Asmt UTSW X 170676361 missense probably benign 0.02
R7737:Asmt UTSW X 170676440 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATAACAGGATGTGACCTCATGG -3'
(R):5'- AAAGTGAACGCCGATGTGC -3'

Sequencing Primer
(F):5'- CGGAACAGGAAGTGACCTCAC -3'
(R):5'- AACGCCGATGTGCGTTTG -3'
Posted On2017-10-10