Incidental Mutation 'R6152:Idh1'
ID 489317
Institutional Source Beutler Lab
Gene Symbol Idh1
Ensembl Gene ENSMUSG00000025950
Gene Name isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms IDPc, Idh-1, Id-1, E030024J03Rik
MMRRC Submission 044299-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6152 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 65197775-65225638 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65198689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 394 (T394A)
Ref Sequence ENSEMBL: ENSMUSP00000127307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097709] [ENSMUST00000169032]
AlphaFold O88844
Predicted Effect probably damaging
Transcript: ENSMUST00000097709
AA Change: T394A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095316
Gene: ENSMUSG00000025950
AA Change: T394A

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169032
AA Change: T394A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127307
Gene: ENSMUSG00000025950
AA Change: T394A

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Electrophoretic variation has been shown in tissues of liver, kidney, spleen and muscle. Strains C57BL/6, C3H/He carry the a allele; DBA/2 carries the b allele; M.m. castaneus and M.m. molossinus carry the c allele; the d allele is found at low frequencyin M. m. molossinus in Japan. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted, other(3) Gene trapped(11)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,204,187 (GRCm39) C363R probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anln A C 9: 22,271,803 (GRCm39) I684R probably damaging Het
Atoh7 A T 10: 62,936,278 (GRCm39) D115V probably damaging Het
Atp11a T A 8: 12,896,100 (GRCm39) I223K probably damaging Het
Cabs1 C T 5: 88,127,613 (GRCm39) T88I possibly damaging Het
Cblb T A 16: 51,961,419 (GRCm39) C345S probably damaging Het
Cep250 A G 2: 155,823,358 (GRCm39) E1003G possibly damaging Het
Chpf C T 1: 75,452,287 (GRCm39) R389H possibly damaging Het
Cntnap5c A G 17: 58,593,881 (GRCm39) D740G possibly damaging Het
Col19a1 T C 1: 24,413,702 (GRCm39) T411A unknown Het
Dgat2 T C 7: 98,813,885 (GRCm39) N99S probably benign Het
Fbxo7 A T 10: 85,860,560 (GRCm39) T56S probably benign Het
Gm15130 T A 2: 110,974,950 (GRCm39) Q71L unknown Het
Gpr161 T A 1: 165,137,864 (GRCm39) V150E possibly damaging Het
Hmcn1 T C 1: 150,441,176 (GRCm39) E5360G probably damaging Het
Hmg20a A G 9: 56,388,892 (GRCm39) D153G probably damaging Het
Hrct1 T A 4: 43,727,498 (GRCm39) V46D possibly damaging Het
Kazn A G 4: 141,836,598 (GRCm39) I547T unknown Het
Klhdc3 A T 17: 46,988,633 (GRCm39) I142N probably damaging Het
Lrrc39 G T 3: 116,364,624 (GRCm39) probably null Het
Mamdc4 T C 2: 25,457,451 (GRCm39) D510G probably damaging Het
Mcm2 TTCTGATAGATGGTCTG TTCTG 6: 88,866,891 (GRCm39) probably benign Het
Ndfip2 A G 14: 105,535,538 (GRCm39) I275V possibly damaging Het
Or1i2 T C 10: 78,448,409 (GRCm39) D22G probably benign Het
Or5b24 A T 19: 12,912,851 (GRCm39) I250L probably benign Het
Pacsin2 A C 15: 83,261,900 (GRCm39) D154E probably damaging Het
Pcdhb5 T A 18: 37,455,886 (GRCm39) C755* probably null Het
Pcnx2 T C 8: 126,480,491 (GRCm39) S1939G probably damaging Het
Pfkl A T 10: 77,825,985 (GRCm39) H602Q probably benign Het
Pon3 G A 6: 5,221,716 (GRCm39) R305C probably damaging Het
Prpf6 A G 2: 181,263,580 (GRCm39) R147G probably damaging Het
Sh3yl1 A G 12: 30,992,034 (GRCm39) E201G probably benign Het
Slc25a36 A G 9: 96,982,210 (GRCm39) Y22H probably damaging Het
Sult6b2 A C 6: 142,750,102 (GRCm39) S5R probably benign Het
Susd2 C T 10: 75,473,853 (GRCm39) A581T probably damaging Het
Tysnd1 A G 10: 61,532,113 (GRCm39) D255G probably damaging Het
Zbtb6 A C 2: 37,319,255 (GRCm39) I224M probably benign Het
Zdhhc8 G T 16: 18,041,202 (GRCm39) N719K possibly damaging Het
Zkscan16 A G 4: 58,946,260 (GRCm39) E45G possibly damaging Het
Other mutations in Idh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Idh1 APN 1 65,205,402 (GRCm39) missense probably damaging 1.00
IGL00790:Idh1 APN 1 65,205,281 (GRCm39) missense possibly damaging 0.94
IGL00979:Idh1 APN 1 65,210,308 (GRCm39) missense probably damaging 1.00
IGL01397:Idh1 APN 1 65,207,754 (GRCm39) missense possibly damaging 0.62
IGL02226:Idh1 APN 1 65,201,081 (GRCm39) missense probably damaging 1.00
IGL02933:Idh1 APN 1 65,201,072 (GRCm39) missense probably damaging 1.00
B5639:Idh1 UTSW 1 65,204,257 (GRCm39) critical splice donor site probably null
R0310:Idh1 UTSW 1 65,201,079 (GRCm39) missense probably damaging 1.00
R0865:Idh1 UTSW 1 65,200,315 (GRCm39) missense probably benign
R1172:Idh1 UTSW 1 65,200,319 (GRCm39) missense probably benign 0.00
R1173:Idh1 UTSW 1 65,200,319 (GRCm39) missense probably benign 0.00
R1174:Idh1 UTSW 1 65,200,319 (GRCm39) missense probably benign 0.00
R1535:Idh1 UTSW 1 65,207,697 (GRCm39) missense probably damaging 1.00
R1833:Idh1 UTSW 1 65,200,273 (GRCm39) missense probably benign
R2135:Idh1 UTSW 1 65,201,078 (GRCm39) missense probably damaging 1.00
R5434:Idh1 UTSW 1 65,214,495 (GRCm39) missense probably benign 0.00
R5478:Idh1 UTSW 1 65,200,997 (GRCm39) missense probably benign 0.04
R5633:Idh1 UTSW 1 65,204,295 (GRCm39) missense probably damaging 1.00
R6249:Idh1 UTSW 1 65,205,378 (GRCm39) missense probably damaging 1.00
R6252:Idh1 UTSW 1 65,207,690 (GRCm39) missense probably benign
R7238:Idh1 UTSW 1 65,205,284 (GRCm39) missense probably damaging 1.00
R7754:Idh1 UTSW 1 65,198,649 (GRCm39) missense probably benign 0.00
R7819:Idh1 UTSW 1 65,204,277 (GRCm39) missense probably damaging 1.00
R8064:Idh1 UTSW 1 65,205,338 (GRCm39) missense probably damaging 1.00
R8078:Idh1 UTSW 1 65,200,225 (GRCm39) missense probably damaging 0.97
R8187:Idh1 UTSW 1 65,198,700 (GRCm39) missense probably damaging 0.98
R8778:Idh1 UTSW 1 65,204,347 (GRCm39) frame shift probably null
R8779:Idh1 UTSW 1 65,204,347 (GRCm39) frame shift probably null
R8791:Idh1 UTSW 1 65,204,347 (GRCm39) frame shift probably null
R8794:Idh1 UTSW 1 65,204,347 (GRCm39) frame shift probably null
R8795:Idh1 UTSW 1 65,204,347 (GRCm39) frame shift probably null
R8799:Idh1 UTSW 1 65,204,347 (GRCm39) frame shift probably null
R8802:Idh1 UTSW 1 65,204,347 (GRCm39) frame shift probably null
R8805:Idh1 UTSW 1 65,204,347 (GRCm39) frame shift probably null
R8935:Idh1 UTSW 1 65,204,378 (GRCm39) missense probably damaging 1.00
R9243:Idh1 UTSW 1 65,207,656 (GRCm39) critical splice donor site probably null
R9326:Idh1 UTSW 1 65,205,416 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCCACCACATTCATTAAGGTG -3'
(R):5'- TCAGTCATGGCCCACAGATTTG -3'

Sequencing Primer
(F):5'- CACATTCATTAAGGTGGCAATAACTG -3'
(R):5'- GGCCCACAGATTTGTAGCTTTTTAAC -3'
Posted On 2017-10-10