Incidental Mutation 'R6152:Prpf6'
ID489325
Institutional Source Beutler Lab
Gene Symbol Prpf6
Ensembl Gene ENSMUSG00000002455
Gene Namepre-mRNA splicing factor 6
SynonymsANT-1, U5-102K, 2610031L17Rik, 1190003A07Rik
MMRRC Submission 044299-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6152 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181591868-181655660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181621787 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 147 (R147G)
Ref Sequence ENSEMBL: ENSMUSP00000121340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002529] [ENSMUST00000136481]
Predicted Effect probably damaging
Transcript: ENSMUST00000002529
AA Change: R147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002529
Gene: ENSMUSG00000002455
AA Change: R147G

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 2.5e-52 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136481
AA Change: R147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121340
Gene: ENSMUSG00000002455
AA Change: R147G

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 1.3e-62 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139955
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,313,361 C363R probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anln A C 9: 22,360,507 I684R probably damaging Het
Atoh7 A T 10: 63,100,499 D115V probably damaging Het
Atp11a T A 8: 12,846,100 I223K probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cblb T A 16: 52,141,056 C345S probably damaging Het
Cep250 A G 2: 155,981,438 E1003G possibly damaging Het
Chpf C T 1: 75,475,643 R389H possibly damaging Het
Cntnap5c A G 17: 58,286,886 D740G possibly damaging Het
Col19a1 T C 1: 24,374,621 T411A unknown Het
Dgat2 T C 7: 99,164,678 N99S probably benign Het
Fbxo7 A T 10: 86,024,696 T56S probably benign Het
Gm15130 T A 2: 111,144,605 Q71L unknown Het
Gpr161 T A 1: 165,310,295 V150E possibly damaging Het
Hmcn1 T C 1: 150,565,425 E5360G probably damaging Het
Hmg20a A G 9: 56,481,608 D153G probably damaging Het
Hrct1 T A 4: 43,727,498 V46D possibly damaging Het
Idh1 T C 1: 65,159,530 T394A probably damaging Het
Kazn A G 4: 142,109,287 I547T unknown Het
Klhdc3 A T 17: 46,677,707 I142N probably damaging Het
Lrrc39 G T 3: 116,570,975 probably null Het
Mamdc4 T C 2: 25,567,439 D510G probably damaging Het
Mcm2 TTCTGATAGATGGTCTG TTCTG 6: 88,889,909 probably benign Het
Ndfip2 A G 14: 105,298,104 I275V possibly damaging Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr1449 A T 19: 12,935,487 I250L probably benign Het
Pacsin2 A C 15: 83,377,699 D154E probably damaging Het
Pcdhb5 T A 18: 37,322,833 C755* probably null Het
Pcnx2 T C 8: 125,753,752 S1939G probably damaging Het
Pfkl A T 10: 77,990,151 H602Q probably benign Het
Pon3 G A 6: 5,221,716 R305C probably damaging Het
Sh3yl1 A G 12: 30,942,035 E201G probably benign Het
Slc25a36 A G 9: 97,100,157 Y22H probably damaging Het
Sult6b2 A C 6: 142,804,376 S5R probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tysnd1 A G 10: 61,696,334 D255G probably damaging Het
Zbtb6 A C 2: 37,429,243 I224M probably benign Het
Zdhhc8 G T 16: 18,223,338 N719K possibly damaging Het
Zkscan16 A G 4: 58,946,260 E45G possibly damaging Het
Other mutations in Prpf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Prpf6 APN 2 181631511 missense probably benign
IGL01729:Prpf6 APN 2 181654917 missense probably damaging 1.00
IGL02077:Prpf6 APN 2 181640664 missense probably damaging 1.00
IGL02187:Prpf6 APN 2 181616016 missense probably damaging 1.00
IGL02452:Prpf6 APN 2 181649085 missense probably benign 0.00
IGL02881:Prpf6 APN 2 181632071 missense probably benign 0.21
IGL03220:Prpf6 APN 2 181632879 missense probably damaging 1.00
IGL02837:Prpf6 UTSW 2 181622263 missense probably damaging 1.00
R0069:Prpf6 UTSW 2 181615963 splice site probably null
R0189:Prpf6 UTSW 2 181655457 missense probably benign 0.00
R0479:Prpf6 UTSW 2 181651127 missense probably benign 0.18
R0532:Prpf6 UTSW 2 181622211 missense possibly damaging 0.71
R0628:Prpf6 UTSW 2 181636048 missense probably damaging 0.96
R0674:Prpf6 UTSW 2 181631974 missense probably benign 0.05
R1863:Prpf6 UTSW 2 181608174 missense possibly damaging 0.81
R1954:Prpf6 UTSW 2 181632077 missense probably benign
R1955:Prpf6 UTSW 2 181632077 missense probably benign
R4612:Prpf6 UTSW 2 181632079 missense possibly damaging 0.81
R4627:Prpf6 UTSW 2 181601474 missense probably damaging 0.96
R5033:Prpf6 UTSW 2 181650106 missense possibly damaging 0.69
R5053:Prpf6 UTSW 2 181649453 missense probably benign 0.00
R5121:Prpf6 UTSW 2 181636043 missense probably benign
R5181:Prpf6 UTSW 2 181649546 missense probably damaging 0.98
R5380:Prpf6 UTSW 2 181608266 missense probably damaging 1.00
R5490:Prpf6 UTSW 2 181608165 missense probably benign 0.01
R5638:Prpf6 UTSW 2 181645588 missense probably benign 0.32
R5680:Prpf6 UTSW 2 181649140 missense probably damaging 0.99
R6252:Prpf6 UTSW 2 181647363 missense probably damaging 1.00
R6317:Prpf6 UTSW 2 181631436 missense probably benign 0.06
R6501:Prpf6 UTSW 2 181621920 nonsense probably null
R6789:Prpf6 UTSW 2 181616051 nonsense probably null
R7023:Prpf6 UTSW 2 181620640 missense probably damaging 1.00
R7043:Prpf6 UTSW 2 181649504 missense probably benign
R7214:Prpf6 UTSW 2 181640596 missense probably damaging 1.00
R7538:Prpf6 UTSW 2 181652455 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGTATCCTCGTGTATGCGTATGC -3'
(R):5'- TCGGGGATCCACAGAAGTATG -3'

Sequencing Primer
(F):5'- GGCTGGCCTTGAACTCAGAAATTC -3'
(R):5'- GGATCCACAGAAGTATGGTTCTCTC -3'
Posted On2017-10-10