Incidental Mutation 'R6152:Hmg20a'
ID489338
Institutional Source Beutler Lab
Gene Symbol Hmg20a
Ensembl Gene ENSMUSG00000032329
Gene Namehigh mobility group 20A
SynonymsHmgxb1, 5730490E10Rik, 1200004E06Rik
MMRRC Submission 044299-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6152 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location56418609-56496936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56481608 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 153 (D153G)
Ref Sequence ENSEMBL: ENSMUSP00000149359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034879] [ENSMUST00000214771] [ENSMUST00000215269] [ENSMUST00000217518]
Predicted Effect probably damaging
Transcript: ENSMUST00000034879
AA Change: D153G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034879
Gene: ENSMUSG00000032329
AA Change: D153G

DomainStartEndE-ValueType
low complexity region 80 94 N/A INTRINSIC
HMG 101 171 1.86e-21 SMART
coiled coil region 228 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214771
Predicted Effect probably damaging
Transcript: ENSMUST00000215269
AA Change: D153G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217518
AA Change: D153G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,313,361 C363R probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anln A C 9: 22,360,507 I684R probably damaging Het
Atoh7 A T 10: 63,100,499 D115V probably damaging Het
Atp11a T A 8: 12,846,100 I223K probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cblb T A 16: 52,141,056 C345S probably damaging Het
Cep250 A G 2: 155,981,438 E1003G possibly damaging Het
Chpf C T 1: 75,475,643 R389H possibly damaging Het
Cntnap5c A G 17: 58,286,886 D740G possibly damaging Het
Col19a1 T C 1: 24,374,621 T411A unknown Het
Dgat2 T C 7: 99,164,678 N99S probably benign Het
Fbxo7 A T 10: 86,024,696 T56S probably benign Het
Gm15130 T A 2: 111,144,605 Q71L unknown Het
Gpr161 T A 1: 165,310,295 V150E possibly damaging Het
Hmcn1 T C 1: 150,565,425 E5360G probably damaging Het
Hrct1 T A 4: 43,727,498 V46D possibly damaging Het
Idh1 T C 1: 65,159,530 T394A probably damaging Het
Kazn A G 4: 142,109,287 I547T unknown Het
Klhdc3 A T 17: 46,677,707 I142N probably damaging Het
Lrrc39 G T 3: 116,570,975 probably null Het
Mamdc4 T C 2: 25,567,439 D510G probably damaging Het
Mcm2 TTCTGATAGATGGTCTG TTCTG 6: 88,889,909 probably benign Het
Ndfip2 A G 14: 105,298,104 I275V possibly damaging Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr1449 A T 19: 12,935,487 I250L probably benign Het
Pacsin2 A C 15: 83,377,699 D154E probably damaging Het
Pcdhb5 T A 18: 37,322,833 C755* probably null Het
Pcnx2 T C 8: 125,753,752 S1939G probably damaging Het
Pfkl A T 10: 77,990,151 H602Q probably benign Het
Pon3 G A 6: 5,221,716 R305C probably damaging Het
Prpf6 A G 2: 181,621,787 R147G probably damaging Het
Sh3yl1 A G 12: 30,942,035 E201G probably benign Het
Slc25a36 A G 9: 97,100,157 Y22H probably damaging Het
Sult6b2 A C 6: 142,804,376 S5R probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tysnd1 A G 10: 61,696,334 D255G probably damaging Het
Zbtb6 A C 2: 37,429,243 I224M probably benign Het
Zdhhc8 G T 16: 18,223,338 N719K possibly damaging Het
Zkscan16 A G 4: 58,946,260 E45G possibly damaging Het
Other mutations in Hmg20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Hmg20a APN 9 56487650 missense probably damaging 1.00
IGL01981:Hmg20a APN 9 56477230 missense probably damaging 1.00
IGL02085:Hmg20a APN 9 56477302 nonsense probably null
IGL03284:Hmg20a APN 9 56481617 missense probably benign 0.25
ANU22:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
P0033:Hmg20a UTSW 9 56489824 missense probably benign 0.01
R0369:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
R0710:Hmg20a UTSW 9 56474670 missense possibly damaging 0.84
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1546:Hmg20a UTSW 9 56467401 missense possibly damaging 0.56
R2188:Hmg20a UTSW 9 56477300 missense possibly damaging 0.93
R4730:Hmg20a UTSW 9 56467419 missense possibly damaging 0.85
R4956:Hmg20a UTSW 9 56481664 missense probably damaging 1.00
R6115:Hmg20a UTSW 9 56489832 missense possibly damaging 0.95
R6130:Hmg20a UTSW 9 56488607 splice site probably null
R6961:Hmg20a UTSW 9 56488728 missense probably benign 0.29
R7499:Hmg20a UTSW 9 56488943 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTTAGTCAGTCAGTCATTCGTTC -3'
(R):5'- AACAGCTGGCTTTACAACATTCC -3'

Sequencing Primer
(F):5'- CTTGCCATAATTGGTAGCAAGCC -3'
(R):5'- AGCTGGCTTTACAACATTCCATCAC -3'
Posted On2017-10-10