Incidental Mutation 'R6152:Olfr1357'
ID489344
Institutional Source Beutler Lab
Gene Symbol Olfr1357
Ensembl Gene ENSMUSG00000071185
Gene Nameolfactory receptor 1357
SynonymsMOR128-4, GA_x6K02T2QGN0-3196801-3197742, MOR128-3
MMRRC Submission 044299-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6152 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location78611003-78618074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78612575 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 22 (D22G)
Ref Sequence ENSEMBL: ENSMUSP00000150167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095473] [ENSMUST00000203305] [ENSMUST00000205085] [ENSMUST00000213877]
Predicted Effect probably benign
Transcript: ENSMUST00000095473
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093127
Gene: ENSMUSG00000071185
AA Change: D22G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203305
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145032
Gene: ENSMUSG00000071185
AA Change: D22G

DomainStartEndE-ValueType
Pfam:7tm_4 31 235 1.3e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 215 7.7e-11 PFAM
Pfam:7tm_1 41 234 3.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205085
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145185
Gene: ENSMUSG00000071185
AA Change: D22G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213877
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,313,361 C363R probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anln A C 9: 22,360,507 I684R probably damaging Het
Atoh7 A T 10: 63,100,499 D115V probably damaging Het
Atp11a T A 8: 12,846,100 I223K probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cblb T A 16: 52,141,056 C345S probably damaging Het
Cep250 A G 2: 155,981,438 E1003G possibly damaging Het
Chpf C T 1: 75,475,643 R389H possibly damaging Het
Cntnap5c A G 17: 58,286,886 D740G possibly damaging Het
Col19a1 T C 1: 24,374,621 T411A unknown Het
Dgat2 T C 7: 99,164,678 N99S probably benign Het
Fbxo7 A T 10: 86,024,696 T56S probably benign Het
Gm15130 T A 2: 111,144,605 Q71L unknown Het
Gpr161 T A 1: 165,310,295 V150E possibly damaging Het
Hmcn1 T C 1: 150,565,425 E5360G probably damaging Het
Hmg20a A G 9: 56,481,608 D153G probably damaging Het
Hrct1 T A 4: 43,727,498 V46D possibly damaging Het
Idh1 T C 1: 65,159,530 T394A probably damaging Het
Kazn A G 4: 142,109,287 I547T unknown Het
Klhdc3 A T 17: 46,677,707 I142N probably damaging Het
Lrrc39 G T 3: 116,570,975 probably null Het
Mamdc4 T C 2: 25,567,439 D510G probably damaging Het
Mcm2 TTCTGATAGATGGTCTG TTCTG 6: 88,889,909 probably benign Het
Ndfip2 A G 14: 105,298,104 I275V possibly damaging Het
Olfr1449 A T 19: 12,935,487 I250L probably benign Het
Pacsin2 A C 15: 83,377,699 D154E probably damaging Het
Pcdhb5 T A 18: 37,322,833 C755* probably null Het
Pcnx2 T C 8: 125,753,752 S1939G probably damaging Het
Pfkl A T 10: 77,990,151 H602Q probably benign Het
Pon3 G A 6: 5,221,716 R305C probably damaging Het
Prpf6 A G 2: 181,621,787 R147G probably damaging Het
Sh3yl1 A G 12: 30,942,035 E201G probably benign Het
Slc25a36 A G 9: 97,100,157 Y22H probably damaging Het
Sult6b2 A C 6: 142,804,376 S5R probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tysnd1 A G 10: 61,696,334 D255G probably damaging Het
Zbtb6 A C 2: 37,429,243 I224M probably benign Het
Zdhhc8 G T 16: 18,223,338 N719K possibly damaging Het
Zkscan16 A G 4: 58,946,260 E45G possibly damaging Het
Other mutations in Olfr1357
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Olfr1357 APN 10 78612126 missense probably benign 0.02
IGL02201:Olfr1357 APN 10 78612270 missense probably damaging 0.96
IGL03029:Olfr1357 APN 10 78611958 missense probably benign 0.14
IGL03094:Olfr1357 APN 10 78612119 missense possibly damaging 0.80
R0207:Olfr1357 UTSW 10 78611871 missense probably benign
R0563:Olfr1357 UTSW 10 78612633 missense probably benign
R0745:Olfr1357 UTSW 10 78612122 missense probably benign 0.02
R1607:Olfr1357 UTSW 10 78612140 missense probably benign 0.08
R2419:Olfr1357 UTSW 10 78612387 missense probably benign 0.34
R4198:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4199:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4200:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4619:Olfr1357 UTSW 10 78612575 missense probably benign
R6836:Olfr1357 UTSW 10 78612590 missense probably damaging 1.00
R6843:Olfr1357 UTSW 10 78612057 missense probably damaging 1.00
R7266:Olfr1357 UTSW 10 78612614 missense probably benign 0.07
R8104:Olfr1357 UTSW 10 78612408 missense probably benign 0.29
Z1176:Olfr1357 UTSW 10 78612056 missense probably damaging 1.00
Z1177:Olfr1357 UTSW 10 78612151 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CTTGGGAACAGTAGTGGAGC -3'
(R):5'- CTTGGAGAACATGAAAACCACTGG -3'

Sequencing Primer
(F):5'- GGATGATGAGCAGGTTTC -3'
(R):5'- CATGAAAACCACTGGAGATAGC -3'
Posted On2017-10-10