Incidental Mutation 'R6152:Ndfip2'
ID489348
Institutional Source Beutler Lab
Gene Symbol Ndfip2
Ensembl Gene ENSMUSG00000053253
Gene NameNedd4 family interacting protein 2
Synonyms0710001O20Rik, 9130207N19Rik, N4wbp5a
MMRRC Submission 044299-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6152 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location105258573-105309298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105298104 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 275 (I275V)
Ref Sequence ENSEMBL: ENSMUSP00000137875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181969]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127286
Predicted Effect unknown
Transcript: ENSMUST00000138283
AA Change: I248V
SMART Domains Protein: ENSMUSP00000121854
Gene: ENSMUSG00000053253
AA Change: I248V

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 103 129 N/A INTRINSIC
Pfam:DUF2370 150 266 1.4e-10 PFAM
transmembrane domain 269 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155351
Predicted Effect possibly damaging
Transcript: ENSMUST00000181969
AA Change: I275V

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137875
Gene: ENSMUSG00000053253
AA Change: I275V

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
low complexity region 55 84 N/A INTRINSIC
low complexity region 129 155 N/A INTRINSIC
Pfam:DUF2370 171 290 2.1e-37 PFAM
Pfam:DUF2370 285 333 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit normal hematological parameters. However, when fed a low iron diet, female homozygotes display a decrease in liver iron content and are able to maintain normal serum iron levels and transferrin saturation, unlike wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,313,361 C363R probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anln A C 9: 22,360,507 I684R probably damaging Het
Atoh7 A T 10: 63,100,499 D115V probably damaging Het
Atp11a T A 8: 12,846,100 I223K probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cblb T A 16: 52,141,056 C345S probably damaging Het
Cep250 A G 2: 155,981,438 E1003G possibly damaging Het
Chpf C T 1: 75,475,643 R389H possibly damaging Het
Cntnap5c A G 17: 58,286,886 D740G possibly damaging Het
Col19a1 T C 1: 24,374,621 T411A unknown Het
Dgat2 T C 7: 99,164,678 N99S probably benign Het
Fbxo7 A T 10: 86,024,696 T56S probably benign Het
Gm15130 T A 2: 111,144,605 Q71L unknown Het
Gpr161 T A 1: 165,310,295 V150E possibly damaging Het
Hmcn1 T C 1: 150,565,425 E5360G probably damaging Het
Hmg20a A G 9: 56,481,608 D153G probably damaging Het
Hrct1 T A 4: 43,727,498 V46D possibly damaging Het
Idh1 T C 1: 65,159,530 T394A probably damaging Het
Kazn A G 4: 142,109,287 I547T unknown Het
Klhdc3 A T 17: 46,677,707 I142N probably damaging Het
Lrrc39 G T 3: 116,570,975 probably null Het
Mamdc4 T C 2: 25,567,439 D510G probably damaging Het
Mcm2 TTCTGATAGATGGTCTG TTCTG 6: 88,889,909 probably benign Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr1449 A T 19: 12,935,487 I250L probably benign Het
Pacsin2 A C 15: 83,377,699 D154E probably damaging Het
Pcdhb5 T A 18: 37,322,833 C755* probably null Het
Pcnx2 T C 8: 125,753,752 S1939G probably damaging Het
Pfkl A T 10: 77,990,151 H602Q probably benign Het
Pon3 G A 6: 5,221,716 R305C probably damaging Het
Prpf6 A G 2: 181,621,787 R147G probably damaging Het
Sh3yl1 A G 12: 30,942,035 E201G probably benign Het
Slc25a36 A G 9: 97,100,157 Y22H probably damaging Het
Sult6b2 A C 6: 142,804,376 S5R probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tysnd1 A G 10: 61,696,334 D255G probably damaging Het
Zbtb6 A C 2: 37,429,243 I224M probably benign Het
Zdhhc8 G T 16: 18,223,338 N719K possibly damaging Het
Zkscan16 A G 4: 58,946,260 E45G possibly damaging Het
Other mutations in Ndfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Bridge_too_far UTSW 14 105294857 missense probably damaging 1.00
PIT4486001:Ndfip2 UTSW 14 105294866 missense probably damaging 1.00
R0189:Ndfip2 UTSW 14 105304740 missense probably damaging 1.00
R2156:Ndfip2 UTSW 14 105287770 missense probably benign 0.07
R4912:Ndfip2 UTSW 14 105258685 missense probably benign 0.00
R5102:Ndfip2 UTSW 14 105298105 missense possibly damaging 0.65
R5759:Ndfip2 UTSW 14 105302316 splice site probably null
R5893:Ndfip2 UTSW 14 105294857 missense probably damaging 1.00
R6645:Ndfip2 UTSW 14 105292273 missense probably damaging 1.00
R7071:Ndfip2 UTSW 14 105302326 missense possibly damaging 0.81
R7196:Ndfip2 UTSW 14 105298038 missense probably damaging 1.00
R7699:Ndfip2 UTSW 14 105287759 missense possibly damaging 0.63
R7700:Ndfip2 UTSW 14 105287759 missense possibly damaging 0.63
R7836:Ndfip2 UTSW 14 105292241 missense probably benign 0.01
R7846:Ndfip2 UTSW 14 105298014 missense probably damaging 1.00
Z1176:Ndfip2 UTSW 14 105258709 missense probably benign 0.00
Z1177:Ndfip2 UTSW 14 105258712 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CATTGCTGGTACCATGTTTCTG -3'
(R):5'- CAGAAGCAATCCCTTTAGGCAG -3'

Sequencing Primer
(F):5'- GCTGGTACCATGTTTCTGTTTATTTG -3'
(R):5'- CCCTTTAGGCAGATTTTAATCAACG -3'
Posted On2017-10-10