Mutagenetix > Incidental Mutations

Incidental Mutation 'R6152:Cblb'

489351

Institutional Source

Beutler Lab

Gene Symbol

Cblb

Ensembl Gene

ENSMUSG00000022637

Gene Name

Casitas B-lineage lymphoma b

Synonyms

Cbl-b

MMRRC Submission

044299-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R6152 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52031225-52208048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52141056 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 345 (C345S)

Ref Sequence

ENSEMBL: ENSMUSP00000153787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114471
AA Change: C345S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: C345S

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
Pfam:Cbl_N	41	167	1.5e-58	PFAM
Pfam:Cbl_N2	171	254	2.9e-43	PFAM
SH2	257	354	3.22e0	SMART
RING	373	411	1.04e-7	SMART
low complexity region	447	454	N/A	INTRINSIC
low complexity region	543	567	N/A	INTRINSIC
low complexity region	666	682	N/A	INTRINSIC
low complexity region	773	783	N/A	INTRINSIC
low complexity region	792	804	N/A	INTRINSIC
low complexity region	857	871	N/A	INTRINSIC
UBA	888	925	4.06e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226593
AA Change: C345S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227062
AA Change: C345S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227756
AA Change: C193S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000227879
AA Change: C345S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,313,361	C363R	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anln	A	C	9: 22,360,507	I684R	probably damaging	Het
Atoh7	A	T	10: 63,100,499	D115V	probably damaging	Het
Atp11a	T	A	8: 12,846,100	I223K	probably damaging	Het
Cabs1	C	T	5: 87,979,754	T88I	possibly damaging	Het
Cep250	A	G	2: 155,981,438	E1003G	possibly damaging	Het
Chpf	C	T	1: 75,475,643	R389H	possibly damaging	Het
Cntnap5c	A	G	17: 58,286,886	D740G	possibly damaging	Het
Col19a1	T	C	1: 24,374,621	T411A	unknown	Het
Dgat2	T	C	7: 99,164,678	N99S	probably benign	Het
Fbxo7	A	T	10: 86,024,696	T56S	probably benign	Het
Gm15130	T	A	2: 111,144,605	Q71L	unknown	Het
Gpr161	T	A	1: 165,310,295	V150E	possibly damaging	Het
Hmcn1	T	C	1: 150,565,425	E5360G	probably damaging	Het
Hmg20a	A	G	9: 56,481,608	D153G	probably damaging	Het
Hrct1	T	A	4: 43,727,498	V46D	possibly damaging	Het
Idh1	T	C	1: 65,159,530	T394A	probably damaging	Het
Kazn	A	G	4: 142,109,287	I547T	unknown	Het
Klhdc3	A	T	17: 46,677,707	I142N	probably damaging	Het
Lrrc39	G	T	3: 116,570,975		probably null	Het
Mamdc4	T	C	2: 25,567,439	D510G	probably damaging	Het
Mcm2	TTCTGATAGATGGTCTG	TTCTG	6: 88,889,909		probably benign	Het
Ndfip2	A	G	14: 105,298,104	I275V	possibly damaging	Het
Olfr1357	T	C	10: 78,612,575	D22G	probably benign	Het
Olfr1449	A	T	19: 12,935,487	I250L	probably benign	Het
Pacsin2	A	C	15: 83,377,699	D154E	probably damaging	Het
Pcdhb5	T	A	18: 37,322,833	C755*	probably null	Het
Pcnx2	T	C	8: 125,753,752	S1939G	probably damaging	Het
Pfkl	A	T	10: 77,990,151	H602Q	probably benign	Het
Pon3	G	A	6: 5,221,716	R305C	probably damaging	Het
Prpf6	A	G	2: 181,621,787	R147G	probably damaging	Het
Sh3yl1	A	G	12: 30,942,035	E201G	probably benign	Het
Slc25a36	A	G	9: 97,100,157	Y22H	probably damaging	Het
Sult6b2	A	C	6: 142,804,376	S5R	probably benign	Het
Susd2	C	T	10: 75,638,019	A581T	probably damaging	Het
Tysnd1	A	G	10: 61,696,334	D255G	probably damaging	Het
Zbtb6	A	C	2: 37,429,243	I224M	probably benign	Het
Zdhhc8	G	T	16: 18,223,338	N719K	possibly damaging	Het
Zkscan16	A	G	4: 58,946,260	E45G	possibly damaging	Het

Other mutations in Cblb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Cblb	APN	16	52183307	missense	probably benign	0.28
IGL00927:Cblb	APN	16	52166098	missense	probably benign
IGL01108:Cblb	APN	16	52047451	critical splice donor site	probably null
IGL01336:Cblb	APN	16	52186229	missense	probably benign	0.00
IGL01943:Cblb	APN	16	52139633	splice site	probably null
IGL02273:Cblb	APN	16	52047294	missense	possibly damaging	0.95
IGL02405:Cblb	APN	16	52166253	missense	probably benign	0.32
IGL02445:Cblb	APN	16	52166305	missense	probably damaging	1.00
IGL02728:Cblb	APN	16	52183309	missense	probably benign	0.04
IGL03000:Cblb	APN	16	52204542	missense	probably damaging	1.00
PIT4362001:Cblb	UTSW	16	52139542	nonsense	probably null
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0294:Cblb	UTSW	16	52135824	missense	probably damaging	1.00
R0403:Cblb	UTSW	16	52152626	missense	probably benign	0.23
R0506:Cblb	UTSW	16	52204480	missense	probably benign	0.25
R1172:Cblb	UTSW	16	52186240	splice site	probably benign
R1245:Cblb	UTSW	16	52047187	splice site	probably benign
R1443:Cblb	UTSW	16	52139611	missense	possibly damaging	0.95
R1549:Cblb	UTSW	16	52033010	splice site	probably benign
R1568:Cblb	UTSW	16	52135829	missense	probably damaging	1.00
R1734:Cblb	UTSW	16	52186240	splice site	probably benign
R2107:Cblb	UTSW	16	52152716	critical splice donor site	probably null
R2231:Cblb	UTSW	16	52194272	missense	probably benign	0.00
R4419:Cblb	UTSW	16	52047258	missense	possibly damaging	0.80
R4913:Cblb	UTSW	16	52166029	missense	possibly damaging	0.78
R4940:Cblb	UTSW	16	52033103	missense	probably damaging	1.00
R5159:Cblb	UTSW	16	52112120	missense	probably damaging	0.97
R5318:Cblb	UTSW	16	52186198	missense	possibly damaging	0.88
R5367:Cblb	UTSW	16	52204653	missense	probably damaging	1.00
R5432:Cblb	UTSW	16	52142865	missense	probably damaging	1.00
R5490:Cblb	UTSW	16	52174370	missense	possibly damaging	0.52
R5618:Cblb	UTSW	16	52152668	missense	possibly damaging	0.89
R6047:Cblb	UTSW	16	52112248	critical splice donor site	probably null
R6667:Cblb	UTSW	16	52152644	missense	possibly damaging	0.81
R6914:Cblb	UTSW	16	52047430	missense	probably damaging	1.00
R7681:Cblb	UTSW	16	52204638	missense	probably damaging	0.96
X0011:Cblb	UTSW	16	52152629	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GATGCAGTTTGATGCTTCCAAG -3'
(R):5'- GCAGCATATCAAGACTGTGGAC -3'

Sequencing Primer
(F):5'- CAGTTTTAGGATAGGCTATAACTCAC -3'
(R):5'- TATCAAGACTGTGGACACTAAAACC -3'

Posted On

2017-10-10