Incidental Mutation 'R6152:Cblb'
ID489351
Institutional Source Beutler Lab
Gene Symbol Cblb
Ensembl Gene ENSMUSG00000022637
Gene NameCasitas B-lineage lymphoma b
SynonymsCbl-b
MMRRC Submission 044299-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R6152 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location52031225-52208048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52141056 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 345 (C345S)
Ref Sequence ENSEMBL: ENSMUSP00000153787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114471
AA Change: C345S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: C345S

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
Pfam:Cbl_N 41 167 1.5e-58 PFAM
Pfam:Cbl_N2 171 254 2.9e-43 PFAM
SH2 257 354 3.22e0 SMART
RING 373 411 1.04e-7 SMART
low complexity region 447 454 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 666 682 N/A INTRINSIC
low complexity region 773 783 N/A INTRINSIC
low complexity region 792 804 N/A INTRINSIC
low complexity region 857 871 N/A INTRINSIC
UBA 888 925 4.06e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226593
AA Change: C345S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227062
AA Change: C345S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000227756
AA Change: C193S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227879
AA Change: C345S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,313,361 C363R probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anln A C 9: 22,360,507 I684R probably damaging Het
Atoh7 A T 10: 63,100,499 D115V probably damaging Het
Atp11a T A 8: 12,846,100 I223K probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cep250 A G 2: 155,981,438 E1003G possibly damaging Het
Chpf C T 1: 75,475,643 R389H possibly damaging Het
Cntnap5c A G 17: 58,286,886 D740G possibly damaging Het
Col19a1 T C 1: 24,374,621 T411A unknown Het
Dgat2 T C 7: 99,164,678 N99S probably benign Het
Fbxo7 A T 10: 86,024,696 T56S probably benign Het
Gm15130 T A 2: 111,144,605 Q71L unknown Het
Gpr161 T A 1: 165,310,295 V150E possibly damaging Het
Hmcn1 T C 1: 150,565,425 E5360G probably damaging Het
Hmg20a A G 9: 56,481,608 D153G probably damaging Het
Hrct1 T A 4: 43,727,498 V46D possibly damaging Het
Idh1 T C 1: 65,159,530 T394A probably damaging Het
Kazn A G 4: 142,109,287 I547T unknown Het
Klhdc3 A T 17: 46,677,707 I142N probably damaging Het
Lrrc39 G T 3: 116,570,975 probably null Het
Mamdc4 T C 2: 25,567,439 D510G probably damaging Het
Mcm2 TTCTGATAGATGGTCTG TTCTG 6: 88,889,909 probably benign Het
Ndfip2 A G 14: 105,298,104 I275V possibly damaging Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr1449 A T 19: 12,935,487 I250L probably benign Het
Pacsin2 A C 15: 83,377,699 D154E probably damaging Het
Pcdhb5 T A 18: 37,322,833 C755* probably null Het
Pcnx2 T C 8: 125,753,752 S1939G probably damaging Het
Pfkl A T 10: 77,990,151 H602Q probably benign Het
Pon3 G A 6: 5,221,716 R305C probably damaging Het
Prpf6 A G 2: 181,621,787 R147G probably damaging Het
Sh3yl1 A G 12: 30,942,035 E201G probably benign Het
Slc25a36 A G 9: 97,100,157 Y22H probably damaging Het
Sult6b2 A C 6: 142,804,376 S5R probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tysnd1 A G 10: 61,696,334 D255G probably damaging Het
Zbtb6 A C 2: 37,429,243 I224M probably benign Het
Zdhhc8 G T 16: 18,223,338 N719K possibly damaging Het
Zkscan16 A G 4: 58,946,260 E45G possibly damaging Het
Other mutations in Cblb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cblb APN 16 52183307 missense probably benign 0.28
IGL00927:Cblb APN 16 52166098 missense probably benign
IGL01108:Cblb APN 16 52047451 critical splice donor site probably null
IGL01336:Cblb APN 16 52186229 missense probably benign 0.00
IGL01943:Cblb APN 16 52139633 splice site probably null
IGL02273:Cblb APN 16 52047294 missense possibly damaging 0.95
IGL02405:Cblb APN 16 52166253 missense probably benign 0.32
IGL02445:Cblb APN 16 52166305 missense probably damaging 1.00
IGL02728:Cblb APN 16 52183309 missense probably benign 0.04
IGL03000:Cblb APN 16 52204542 missense probably damaging 1.00
PIT4362001:Cblb UTSW 16 52139542 nonsense probably null
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0294:Cblb UTSW 16 52135824 missense probably damaging 1.00
R0403:Cblb UTSW 16 52152626 missense probably benign 0.23
R0506:Cblb UTSW 16 52204480 missense probably benign 0.25
R1172:Cblb UTSW 16 52186240 splice site probably benign
R1245:Cblb UTSW 16 52047187 splice site probably benign
R1443:Cblb UTSW 16 52139611 missense possibly damaging 0.95
R1549:Cblb UTSW 16 52033010 splice site probably benign
R1568:Cblb UTSW 16 52135829 missense probably damaging 1.00
R1734:Cblb UTSW 16 52186240 splice site probably benign
R2107:Cblb UTSW 16 52152716 critical splice donor site probably null
R2231:Cblb UTSW 16 52194272 missense probably benign 0.00
R4419:Cblb UTSW 16 52047258 missense possibly damaging 0.80
R4913:Cblb UTSW 16 52166029 missense possibly damaging 0.78
R4940:Cblb UTSW 16 52033103 missense probably damaging 1.00
R5159:Cblb UTSW 16 52112120 missense probably damaging 0.97
R5318:Cblb UTSW 16 52186198 missense possibly damaging 0.88
R5367:Cblb UTSW 16 52204653 missense probably damaging 1.00
R5432:Cblb UTSW 16 52142865 missense probably damaging 1.00
R5490:Cblb UTSW 16 52174370 missense possibly damaging 0.52
R5618:Cblb UTSW 16 52152668 missense possibly damaging 0.89
R6047:Cblb UTSW 16 52112248 critical splice donor site probably null
R6667:Cblb UTSW 16 52152644 missense possibly damaging 0.81
R6914:Cblb UTSW 16 52047430 missense probably damaging 1.00
R7681:Cblb UTSW 16 52204638 missense probably damaging 0.96
X0011:Cblb UTSW 16 52152629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATGCAGTTTGATGCTTCCAAG -3'
(R):5'- GCAGCATATCAAGACTGTGGAC -3'

Sequencing Primer
(F):5'- CAGTTTTAGGATAGGCTATAACTCAC -3'
(R):5'- TATCAAGACTGTGGACACTAAAACC -3'
Posted On2017-10-10