Incidental Mutation 'R6153:Mecom'
ID489363
Institutional Source Beutler Lab
Gene Symbol Mecom
Ensembl Gene ENSMUSG00000027684
Gene NameMDS1 and EVI1 complex locus
SynonymsEvi1, Jbo, D630039M04Rik, ZNFPR1B1, Evi-1, Prdm3, Mds1, MDS1-EVI1
MMRRC Submission 044300-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6153 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location29951296-30548008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29993648 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000134117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108270] [ENSMUST00000108271] [ENSMUST00000166001] [ENSMUST00000172694] [ENSMUST00000172697] [ENSMUST00000172754] [ENSMUST00000173495] [ENSMUST00000173899] [ENSMUST00000174406]
Predicted Effect unknown
Transcript: ENSMUST00000108270
AA Change: E35G
SMART Domains Protein: ENSMUSP00000103905
Gene: ENSMUSG00000027684
AA Change: E35G

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 188 210 8.22e-2 SMART
ZnF_C2H2 217 244 9.96e0 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 724 746 5.29e-5 SMART
ZnF_C2H2 752 775 1.6e-4 SMART
ZnF_C2H2 781 803 5.9e-3 SMART
low complexity region 877 896 N/A INTRINSIC
low complexity region 1025 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108271
AA Change: E112G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103906
Gene: ENSMUSG00000027684
AA Change: E112G

DomainStartEndE-ValueType
Blast:SET 9 85 3e-44 BLAST
PDB:2JV0|A 25 96 2e-12 PDB
ZnF_C2H2 98 118 1.86e1 SMART
ZnF_C2H2 152 174 4.47e-3 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 231 1.13e-4 SMART
ZnF_C2H2 237 259 1.2e-3 SMART
ZnF_C2H2 477 499 5.29e-5 SMART
ZnF_C2H2 505 528 1.6e-4 SMART
ZnF_C2H2 534 556 5.9e-3 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 778 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166001
AA Change: E35G

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128563
Gene: ENSMUSG00000027684
AA Change: E35G

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 188 210 8.22e-2 SMART
ZnF_C2H2 217 244 9.96e0 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 5.29e-5 SMART
ZnF_C2H2 761 784 1.6e-4 SMART
ZnF_C2H2 790 812 5.9e-3 SMART
low complexity region 886 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170212
Predicted Effect probably benign
Transcript: ENSMUST00000172694
AA Change: E35G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134303
Gene: ENSMUSG00000027684
AA Change: E35G

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 400 422 5.29e-5 SMART
ZnF_C2H2 428 451 1.6e-4 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
low complexity region 553 572 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172697
AA Change: E225G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134117
Gene: ENSMUSG00000027684
AA Change: E225G

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 923 945 5.29e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172754
Predicted Effect unknown
Transcript: ENSMUST00000173059
AA Change: E159G
SMART Domains Protein: ENSMUSP00000133310
Gene: ENSMUSG00000027684
AA Change: E159G

DomainStartEndE-ValueType
SET 15 133 5.46e-15 SMART
ZnF_C2H2 146 166 1.86e1 SMART
ZnF_C2H2 200 222 4.47e-3 SMART
ZnF_C2H2 228 250 1.6e-4 SMART
ZnF_C2H2 256 279 1.13e-4 SMART
ZnF_C2H2 285 307 1.2e-3 SMART
ZnF_C2H2 525 547 5.29e-5 SMART
ZnF_C2H2 553 576 1.6e-4 SMART
ZnF_C2H2 582 604 5.9e-3 SMART
low complexity region 678 697 N/A INTRINSIC
low complexity region 826 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173495
AA Change: E35G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134626
Gene: ENSMUSG00000027684
AA Change: E35G

DomainStartEndE-ValueType
ZnF_C2H2 21 41 8e-2 SMART
ZnF_C2H2 75 97 1.9e-5 SMART
ZnF_C2H2 103 125 7e-7 SMART
ZnF_C2H2 131 154 4.8e-7 SMART
ZnF_C2H2 160 182 5e-6 SMART
ZnF_C2H2 188 210 3.5e-4 SMART
ZnF_C2H2 217 244 4.3e-2 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 2.2e-7 SMART
ZnF_C2H2 761 784 7.1e-7 SMART
ZnF_C2H2 790 812 2.5e-5 SMART
low complexity region 886 905 N/A INTRINSIC
low complexity region 1034 1049 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173899
AA Change: E225G
SMART Domains Protein: ENSMUSP00000133410
Gene: ENSMUSG00000027684
AA Change: E225G

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 914 936 5.29e-5 SMART
ZnF_C2H2 942 965 1.6e-4 SMART
ZnF_C2H2 971 993 5.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174406
SMART Domains Protein: ENSMUSP00000133942
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
Blast:SET 1 53 1e-33 BLAST
PDB:2QPW|A 11 52 6e-7 PDB
Predicted Effect unknown
Transcript: ENSMUST00000174413
AA Change: E24G
SMART Domains Protein: ENSMUSP00000134278
Gene: ENSMUSG00000027684
AA Change: E24G

DomainStartEndE-ValueType
ZnF_C2H2 11 31 1.86e1 SMART
ZnF_C2H2 65 87 4.47e-3 SMART
ZnF_C2H2 93 115 1.6e-4 SMART
ZnF_C2H2 121 144 1.13e-4 SMART
ZnF_C2H2 150 172 1.2e-3 SMART
ZnF_C2H2 390 412 5.29e-5 SMART
ZnF_C2H2 418 441 1.6e-4 SMART
ZnF_C2H2 447 469 5.9e-3 SMART
low complexity region 543 562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174428
Meta Mutation Damage Score 0.1895 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at 10.5 dpc displaying widespread hypocellularity, hemorrhage, and disruption in the development of the heart, somites, and neural crest-derived cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,301,259 probably null Het
Ache T C 5: 137,291,855 I394T probably damaging Het
Acsm1 G A 7: 119,633,066 G62D probably damaging Het
Actrt3 T A 3: 30,599,750 I34F probably damaging Het
Adgrf5 T C 17: 43,451,083 I1223T possibly damaging Het
Adora2a T C 10: 75,326,147 F40S possibly damaging Het
Ano8 T C 8: 71,480,797 probably benign Het
Arid1b T A 17: 5,242,832 L675Q probably damaging Het
Atg2b T C 12: 105,623,482 I1837V possibly damaging Het
Atp10b A G 11: 43,254,282 Y1284C probably damaging Het
B3gnt7 G T 1: 86,305,515 G44V probably damaging Het
Chrna1 G T 2: 73,573,309 H99N probably benign Het
Cnksr1 T C 4: 134,233,893 H220R probably damaging Het
Cpsf2 T A 12: 101,999,360 probably null Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Daglb T C 5: 143,503,341 L651P probably benign Het
Ddx60 A G 8: 61,945,940 D231G possibly damaging Het
Ehd4 A C 2: 120,102,423 F174C probably damaging Het
Emsy G T 7: 98,610,853 P9T probably damaging Het
Fnbp1l T C 3: 122,559,156 E217G probably benign Het
Gm11596 A T 11: 99,792,698 C199S unknown Het
Gmps T G 3: 64,001,543 C489G probably benign Het
Gpsm1 T C 2: 26,325,413 Y296H probably benign Het
Heatr5b T C 17: 78,831,441 T91A possibly damaging Het
Hs3st3b1 A T 11: 63,889,498 W268R probably damaging Het
Il27ra T C 8: 84,032,144 probably null Het
Itga5 T A 15: 103,357,453 I156F probably damaging Het
Kcnmb3 T A 3: 32,473,827 D96V probably damaging Het
Khdrbs1 T A 4: 129,716,172 N417Y probably damaging Het
Loxhd1 A G 18: 77,295,758 N118D possibly damaging Het
Mdm4 A G 1: 132,992,107 L341P probably damaging Het
Megf8 G A 7: 25,347,371 G1560S possibly damaging Het
Mfsd13a A T 19: 46,367,882 D142V probably damaging Het
Muc5b A T 7: 141,861,444 Y2709F possibly damaging Het
Nelfa A T 5: 33,898,879 I480N probably damaging Het
Olfr1329 G A 4: 118,916,747 S240F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Palld G T 8: 61,550,152 N304K probably damaging Het
Pcsk5 A G 19: 17,511,492 L988P probably damaging Het
Prmt1 A T 7: 44,981,827 F34I probably damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Ralb A T 1: 119,478,140 probably null Het
Robo2 T A 16: 73,920,729 D141V probably damaging Het
Rsrc1 T C 3: 67,355,562 I283T probably benign Het
Sec62 A T 3: 30,810,482 K165M unknown Het
Sez6 A G 11: 77,977,822 D974G probably damaging Het
Shc2 T A 10: 79,629,918 I187F possibly damaging Het
Shroom3 G A 5: 92,964,408 R1876Q probably damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Skil T A 3: 31,097,853 F175I probably damaging Het
Slc1a1 T C 19: 28,909,535 V432A probably damaging Het
Slit3 G T 11: 35,700,483 G1374V possibly damaging Het
Snx14 T C 9: 88,391,806 Y644C probably damaging Het
Snx33 T A 9: 56,926,699 I29F possibly damaging Het
Sos1 T A 17: 80,449,335 I263L probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tbpl2 C A 2: 24,076,016 V320F probably damaging Het
Tmem209 A G 6: 30,505,795 S171P probably benign Het
Tprkb T A 6: 85,916,190 probably null Het
Tspan11 G A 6: 127,939,098 S119N probably benign Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Zfp976 A C 7: 42,614,186 Y76D probably damaging Het
Zkscan2 G A 7: 123,489,770 T426I probably benign Het
Other mutations in Mecom
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Mecom APN 3 29963166 missense probably damaging 0.99
IGL02800:Mecom APN 3 29961034 missense probably damaging 1.00
IGL03052:Mecom APN 3 29960963 splice site probably benign
IGL03237:Mecom APN 3 29956499 intron probably benign
R0004:Mecom UTSW 3 29979911 missense probably damaging 1.00
R0299:Mecom UTSW 3 29980411 missense probably benign 0.41
R0324:Mecom UTSW 3 29963112 missense probably damaging 0.99
R0485:Mecom UTSW 3 29980972 intron probably benign
R0696:Mecom UTSW 3 29956389 missense probably benign 0.01
R1322:Mecom UTSW 3 29957373 missense probably damaging 0.98
R1396:Mecom UTSW 3 29979800 missense possibly damaging 0.50
R1419:Mecom UTSW 3 29980889 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1487:Mecom UTSW 3 29980064 missense probably damaging 1.00
R1620:Mecom UTSW 3 29987088 missense probably damaging 1.00
R1867:Mecom UTSW 3 30509428 critical splice donor site probably null
R1876:Mecom UTSW 3 29993658 missense probably damaging 1.00
R1922:Mecom UTSW 3 29957442 missense probably damaging 0.99
R2044:Mecom UTSW 3 29980592 missense probably damaging 1.00
R2087:Mecom UTSW 3 29952814 missense probably benign 0.01
R2116:Mecom UTSW 3 29965458 missense probably damaging 1.00
R3500:Mecom UTSW 3 29980912 missense probably damaging 1.00
R4348:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4350:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4351:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4352:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4353:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4358:Mecom UTSW 3 29979785 nonsense probably null
R4370:Mecom UTSW 3 29957355 missense probably damaging 1.00
R4380:Mecom UTSW 3 29987070 missense probably damaging 1.00
R4676:Mecom UTSW 3 30268668 intron probably benign
R4690:Mecom UTSW 3 30238310 missense probably benign 0.01
R4750:Mecom UTSW 3 29957530 missense probably damaging 0.97
R4812:Mecom UTSW 3 30140368 start codon destroyed probably null
R4821:Mecom UTSW 3 29985351 missense probably damaging 1.00
R4986:Mecom UTSW 3 29980699 missense probably damaging 0.99
R5020:Mecom UTSW 3 29961106 missense probably damaging 1.00
R5099:Mecom UTSW 3 29985316 intron probably benign
R5410:Mecom UTSW 3 29997721 missense probably benign 0.01
R5415:Mecom UTSW 3 29957526 missense possibly damaging 0.93
R5556:Mecom UTSW 3 30238100 missense probably damaging 1.00
R5811:Mecom UTSW 3 29961000 missense probably benign 0.00
R5955:Mecom UTSW 3 29961046 missense probably damaging 1.00
R6321:Mecom UTSW 3 29980592 missense probably damaging 1.00
R6335:Mecom UTSW 3 29980756 missense probably damaging 1.00
R6383:Mecom UTSW 3 29997726 missense probably damaging 1.00
R6435:Mecom UTSW 3 29980249 missense probably damaging 1.00
R6468:Mecom UTSW 3 30140386 intron probably benign
R6476:Mecom UTSW 3 29980568 missense possibly damaging 0.70
R6673:Mecom UTSW 3 29980702 missense probably benign 0.09
R6721:Mecom UTSW 3 29979874 missense probably damaging 1.00
R7071:Mecom UTSW 3 29980708 missense probably damaging 1.00
R7095:Mecom UTSW 3 29980954 missense probably damaging 1.00
R7131:Mecom UTSW 3 29980945 missense probably damaging 1.00
R7247:Mecom UTSW 3 30140356 missense unknown
R7265:Mecom UTSW 3 29980133 missense possibly damaging 0.65
R7556:Mecom UTSW 3 29987071 missense probably benign 0.01
R7599:Mecom UTSW 3 29956385 missense probably damaging 0.96
R7609:Mecom UTSW 3 29956442 missense probably damaging 0.99
R7844:Mecom UTSW 3 30009824 missense unknown
R8047:Mecom UTSW 3 30238255 missense
R8070:Mecom UTSW 3 29979838 missense probably damaging 1.00
R8316:Mecom UTSW 3 29957380 missense probably benign 0.01
R8351:Mecom UTSW 3 29985370 missense probably benign 0.00
R8451:Mecom UTSW 3 29985370 missense probably benign 0.00
R8757:Mecom UTSW 3 30238119 missense
Predicted Primers PCR Primer
(F):5'- GGCCAGTTGTTTTGAAGCTC -3'
(R):5'- TCTTTCTAAGCAAACTATGGGCTG -3'

Sequencing Primer
(F):5'- GCATAACACTTTGCTGCAGAG -3'
(R):5'- GTGTTTTGTGTAACTCCATAAGACG -3'
Posted On2017-10-10