Incidental Mutation 'R6153:Sec62'
ID489365
Institutional Source Beutler Lab
Gene Symbol Sec62
Ensembl Gene ENSMUSG00000027706
Gene NameSEC62 homolog (S. cerevisiae)
Synonyms3100002M17Rik, Dtrp1, Tloc1, HTP1, SEC62
MMRRC Submission 044300-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R6153 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location30792875-30821263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30810482 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 165 (K165M)
Ref Sequence ENSEMBL: ENSMUSP00000029256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029256]
Predicted Effect unknown
Transcript: ENSMUST00000029256
AA Change: K165M
SMART Domains Protein: ENSMUSP00000029256
Gene: ENSMUSG00000027706
AA Change: K165M

DomainStartEndE-ValueType
Pfam:Sec62 87 311 1.1e-78 PFAM
low complexity region 338 357 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Meta Mutation Damage Score 0.4031 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC63 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,301,259 probably null Het
Ache T C 5: 137,291,855 I394T probably damaging Het
Acsm1 G A 7: 119,633,066 G62D probably damaging Het
Actrt3 T A 3: 30,599,750 I34F probably damaging Het
Adgrf5 T C 17: 43,451,083 I1223T possibly damaging Het
Adora2a T C 10: 75,326,147 F40S possibly damaging Het
Ano8 T C 8: 71,480,797 probably benign Het
Arid1b T A 17: 5,242,832 L675Q probably damaging Het
Atg2b T C 12: 105,623,482 I1837V possibly damaging Het
Atp10b A G 11: 43,254,282 Y1284C probably damaging Het
B3gnt7 G T 1: 86,305,515 G44V probably damaging Het
Chrna1 G T 2: 73,573,309 H99N probably benign Het
Cnksr1 T C 4: 134,233,893 H220R probably damaging Het
Cpsf2 T A 12: 101,999,360 probably null Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Daglb T C 5: 143,503,341 L651P probably benign Het
Ddx60 A G 8: 61,945,940 D231G possibly damaging Het
Ehd4 A C 2: 120,102,423 F174C probably damaging Het
Emsy G T 7: 98,610,853 P9T probably damaging Het
Fnbp1l T C 3: 122,559,156 E217G probably benign Het
Gm11596 A T 11: 99,792,698 C199S unknown Het
Gmps T G 3: 64,001,543 C489G probably benign Het
Gpsm1 T C 2: 26,325,413 Y296H probably benign Het
Heatr5b T C 17: 78,831,441 T91A possibly damaging Het
Hs3st3b1 A T 11: 63,889,498 W268R probably damaging Het
Il27ra T C 8: 84,032,144 probably null Het
Itga5 T A 15: 103,357,453 I156F probably damaging Het
Kcnmb3 T A 3: 32,473,827 D96V probably damaging Het
Khdrbs1 T A 4: 129,716,172 N417Y probably damaging Het
Loxhd1 A G 18: 77,295,758 N118D possibly damaging Het
Mdm4 A G 1: 132,992,107 L341P probably damaging Het
Mecom T C 3: 29,993,648 E225G possibly damaging Het
Megf8 G A 7: 25,347,371 G1560S possibly damaging Het
Mfsd13a A T 19: 46,367,882 D142V probably damaging Het
Muc5b A T 7: 141,861,444 Y2709F possibly damaging Het
Nelfa A T 5: 33,898,879 I480N probably damaging Het
Olfr1329 G A 4: 118,916,747 S240F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Palld G T 8: 61,550,152 N304K probably damaging Het
Pcsk5 A G 19: 17,511,492 L988P probably damaging Het
Prmt1 A T 7: 44,981,827 F34I probably damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Ralb A T 1: 119,478,140 probably null Het
Robo2 T A 16: 73,920,729 D141V probably damaging Het
Rsrc1 T C 3: 67,355,562 I283T probably benign Het
Sez6 A G 11: 77,977,822 D974G probably damaging Het
Shc2 T A 10: 79,629,918 I187F possibly damaging Het
Shroom3 G A 5: 92,964,408 R1876Q probably damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Skil T A 3: 31,097,853 F175I probably damaging Het
Slc1a1 T C 19: 28,909,535 V432A probably damaging Het
Slit3 G T 11: 35,700,483 G1374V possibly damaging Het
Snx14 T C 9: 88,391,806 Y644C probably damaging Het
Snx33 T A 9: 56,926,699 I29F possibly damaging Het
Sos1 T A 17: 80,449,335 I263L probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tbpl2 C A 2: 24,076,016 V320F probably damaging Het
Tmem209 A G 6: 30,505,795 S171P probably benign Het
Tprkb T A 6: 85,916,190 probably null Het
Tspan11 G A 6: 127,939,098 S119N probably benign Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Zfp976 A C 7: 42,614,186 Y76D probably damaging Het
Zkscan2 G A 7: 123,489,770 T426I probably benign Het
Other mutations in Sec62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sec62 APN 3 30810442 splice site probably benign
IGL01359:Sec62 APN 3 30814306 missense unknown
IGL01746:Sec62 APN 3 30814246 missense probably benign 0.39
IGL02437:Sec62 APN 3 30818847 missense unknown
IGL03355:Sec62 APN 3 30809922 missense unknown
R2400:Sec62 UTSW 3 30810532 missense unknown
R4423:Sec62 UTSW 3 30814282 missense unknown
R4649:Sec62 UTSW 3 30810534 missense unknown
R4717:Sec62 UTSW 3 30809871 missense unknown
R4837:Sec62 UTSW 3 30809869 missense unknown
R5775:Sec62 UTSW 3 30793287 utr 5 prime probably benign
R6275:Sec62 UTSW 3 30809836 missense probably damaging 0.98
R6734:Sec62 UTSW 3 30810460 missense probably benign 0.39
R7216:Sec62 UTSW 3 30818829 nonsense probably null
R7250:Sec62 UTSW 3 30812347 missense possibly damaging 0.57
R7453:Sec62 UTSW 3 30809796 intron probably null
Predicted Primers PCR Primer
(F):5'- GCCATGTGAGATACCTGCCATG -3'
(R):5'- GGAAACCTGTGTTGTACTAAGC -3'

Sequencing Primer
(F):5'- CCTGCCATGATTATTTGTAAACACCG -3'
(R):5'- CTGATTCTAACTAGATTAGAAACGT -3'
Posted On2017-10-10