Incidental Mutation 'R0526:Ect2l'
ID48938
Institutional Source Beutler Lab
Gene Symbol Ect2l
Ensembl Gene ENSMUSG00000071392
Gene Nameepithelial cell transforming sequence 2 oncogene-like
SynonymsC330021H03Rik, Gm10331
MMRRC Submission 038719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0526 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18128903-18210890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18199940 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 66 (C66F)
Ref Sequence ENSEMBL: ENSMUSP00000146899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095817] [ENSMUST00000207827] [ENSMUST00000208948] [ENSMUST00000209178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095817
AA Change: C66F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093497
Gene: ENSMUSG00000071392
AA Change: C66F

DomainStartEndE-ValueType
FBOX 93 133 3.5e-4 SMART
Pfam:DUF4347 297 468 1.4e-11 PFAM
RhoGEF 578 761 6.3e-46 SMART
Blast:PH 793 909 6e-49 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207148
Predicted Effect possibly damaging
Transcript: ENSMUST00000207827
AA Change: C66F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208948
AA Change: C66F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000209178
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,455,224 N230I possibly damaging Het
4933427D14Rik G T 11: 72,169,783 Q687K probably damaging Het
Actrt2 A G 4: 154,667,412 L89P probably damaging Het
Adamts1 A C 16: 85,802,372 S113R probably benign Het
Agxt2 G T 15: 10,373,862 C118F probably damaging Het
Akap8 G A 17: 32,317,292 T49I probably benign Het
Alk A T 17: 71,869,753 W1519R probably damaging Het
Atf7ip T A 6: 136,559,805 F12Y probably damaging Het
Atp13a5 A G 16: 29,348,740 C131R probably damaging Het
Atp8b4 A G 2: 126,427,363 L168P probably damaging Het
Blm G T 7: 80,505,893 S346* probably null Het
Ccnt2 T G 1: 127,799,445 C199G probably damaging Het
Cd151 A T 7: 141,470,591 H219L probably damaging Het
Cd200r2 A T 16: 44,915,047 R248S probably damaging Het
Cdh3 A G 8: 106,555,446 D822G possibly damaging Het
Clec4b1 T C 6: 123,069,770 probably null Het
Cluh C A 11: 74,665,986 L951I probably benign Het
Cog7 A T 7: 121,963,271 probably null Het
Col25a1 C A 3: 130,476,394 P197Q probably damaging Het
Csde1 T A 3: 103,056,426 S636R possibly damaging Het
Elac2 T C 11: 64,999,436 M671T probably benign Het
Evi5 T C 5: 107,821,748 N143S probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fbxo38 A G 18: 62,505,980 Y1084H probably damaging Het
Fcgr4 T A 1: 171,029,191 L209Q probably damaging Het
Fgd3 C T 13: 49,296,524 S83N probably benign Het
Gigyf2 T A 1: 87,421,493 M664K probably benign Het
Gm38394 T C 1: 133,658,734 I288M probably damaging Het
Il27ra A T 8: 84,039,499 S219T probably benign Het
Kif15 T C 9: 122,997,797 V800A probably damaging Het
Lmo7 T A 14: 101,900,560 D666E probably damaging Het
Lrp5 T C 19: 3,628,295 D520G probably damaging Het
Lrriq3 T A 3: 155,188,297 M545K probably benign Het
Lsm5 T A 6: 56,703,325 D44V probably damaging Het
Man1c1 G T 4: 134,569,068 Y430* probably null Het
Map4 T A 9: 110,037,278 probably null Het
Megf6 A G 4: 154,258,941 K561R probably benign Het
Myo1e T C 9: 70,322,398 Y173H probably damaging Het
Myo6 T A 9: 80,283,541 S791R possibly damaging Het
Nol11 C A 11: 107,184,771 E144* probably null Het
Ntng2 C T 2: 29,197,062 R416Q probably damaging Het
Nxpe3 T A 16: 55,866,517 I43F possibly damaging Het
Olfr1093 A T 2: 86,786,347 T206S possibly damaging Het
Olfr1284 T A 2: 111,379,492 V164E possibly damaging Het
Pkd1l2 T C 8: 117,082,260 I64V probably damaging Het
Prf1 G A 10: 61,300,254 R103H probably benign Het
Rest A G 5: 77,281,027 D431G probably damaging Het
Serpina10 A T 12: 103,616,868 L439Q probably damaging Het
Sgk3 T G 1: 9,881,579 V176G probably damaging Het
Slc19a3 A G 1: 83,022,733 S188P probably damaging Het
Sorbs1 A G 19: 40,349,948 I336T probably damaging Het
Ssfa2 A G 2: 79,657,346 D591G probably benign Het
Strip1 C T 3: 107,620,039 probably null Het
Syt4 T C 18: 31,443,746 E185G possibly damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tgfbr3l G T 8: 4,249,439 R74L possibly damaging Het
Thoc7 A G 14: 13,949,282 M194T probably benign Het
Thsd7b T C 1: 129,951,392 Y989H probably damaging Het
Tmem156 C T 5: 65,075,818 V134I probably benign Het
Tnks A T 8: 34,853,303 V738E probably benign Het
Trpm6 A T 19: 18,792,876 I342F probably damaging Het
Vmn2r69 A T 7: 85,411,503 V291D probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wnk1 T C 6: 119,951,992 T1292A probably damaging Het
Yes1 T A 5: 32,655,240 C285S probably benign Het
Zbtb49 T C 5: 38,213,919 N206S probably benign Het
Other mutations in Ect2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Ect2l APN 10 18130730 missense probably damaging 1.00
IGL01773:Ect2l APN 10 18161504 missense probably damaging 0.97
IGL02293:Ect2l APN 10 18140511 critical splice donor site probably null
IGL02589:Ect2l APN 10 18140594 splice site probably benign
IGL02866:Ect2l APN 10 18159817 missense probably damaging 1.00
R0037:Ect2l UTSW 10 18143097 missense probably damaging 1.00
R0628:Ect2l UTSW 10 18143040 missense probably damaging 1.00
R0839:Ect2l UTSW 10 18141904 missense probably benign 0.03
R0948:Ect2l UTSW 10 18140586 missense probably damaging 1.00
R1103:Ect2l UTSW 10 18140526 missense probably damaging 1.00
R1238:Ect2l UTSW 10 18143104 missense possibly damaging 0.94
R1326:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1327:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1544:Ect2l UTSW 10 18168434 missense probably benign 0.04
R1848:Ect2l UTSW 10 18200033 missense probably damaging 1.00
R1921:Ect2l UTSW 10 18143004 missense possibly damaging 0.89
R1938:Ect2l UTSW 10 18144635 missense probably benign 0.00
R2081:Ect2l UTSW 10 18165527 missense probably damaging 1.00
R3551:Ect2l UTSW 10 18163393 missense probably damaging 1.00
R3608:Ect2l UTSW 10 18142940 missense possibly damaging 0.92
R3886:Ect2l UTSW 10 18168458 missense probably damaging 1.00
R4120:Ect2l UTSW 10 18130718 missense probably benign 0.00
R4348:Ect2l UTSW 10 18136988 missense probably damaging 1.00
R4992:Ect2l UTSW 10 18172729 missense probably benign 0.00
R5053:Ect2l UTSW 10 18140345 missense probably damaging 1.00
R5144:Ect2l UTSW 10 18144577 missense probably benign 0.03
R5654:Ect2l UTSW 10 18143062 missense probably damaging 0.99
R5779:Ect2l UTSW 10 18163438 missense probably benign 0.09
R5814:Ect2l UTSW 10 18200009 missense probably damaging 0.97
R6053:Ect2l UTSW 10 18141844 missense probably damaging 1.00
R6057:Ect2l UTSW 10 18161502 missense probably benign 0.02
R6244:Ect2l UTSW 10 18140397 missense possibly damaging 0.93
R6720:Ect2l UTSW 10 18140264 missense probably damaging 1.00
R6817:Ect2l UTSW 10 18174059 missense probably benign 0.00
R6894:Ect2l UTSW 10 18169380 critical splice donor site probably null
R7199:Ect2l UTSW 10 18129146 missense probably benign 0.02
R7313:Ect2l UTSW 10 18168401 missense probably damaging 0.98
R7404:Ect2l UTSW 10 18159781 missense probably damaging 0.99
R7482:Ect2l UTSW 10 18168454 missense probably benign 0.07
X0018:Ect2l UTSW 10 18130652 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGCTAGGAGAATCTGCATAAGCCTTAAA -3'
(R):5'- GCTTGCCTGTATTGCTAGATAAAAGCAC -3'

Sequencing Primer
(F):5'- cccaaaatcacccacaagaaac -3'
(R):5'- GGAAAAACCCTACAGCCTATGTG -3'
Posted On2013-06-12