Incidental Mutation 'R0526:Prf1'
ID48939
Institutional Source Beutler Lab
Gene Symbol Prf1
Ensembl Gene ENSMUSG00000037202
Gene Nameperforin 1 (pore forming protein)
SynonymsPfn, Prf-1, perforin, Pfp
MMRRC Submission 038719-MU
Accession Numbers

Ncbi RefSeq: NM_011073; MGI: 97551

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0526 (G1)
Quality Score95
Status Not validated
Chromosome10
Chromosomal Location61297833-61304680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61300254 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 103 (R103H)
Ref Sequence ENSEMBL: ENSMUSP00000151354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035419] [ENSMUST00000219375]
Predicted Effect probably benign
Transcript: ENSMUST00000035419
AA Change: R103H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000041483
Gene: ENSMUSG00000037202
AA Change: R103H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MACPF 165 368 1.84e-80 SMART
C2 415 516 1.59e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219375
AA Change: R103H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has structural and functional similarities to complement component 9 (C9). Like C9, this protein creates transmembrane tubules and is capable of lysing non-specifically a variety of target cells. This protein is one of the main cytolytic proteins of cytolytic granules, and it is known to be a key effector molecule for T-cell- and natural killer-cell-mediated cytolysis. Defects in this gene cause familial hemophagocytic lymphohistiocytosis type 2 (HPLH2), a rare and lethal autosomal recessive disorder of early childhood. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit increased susceptibility to viral infection and defective cytotoxic T cell cytolysis and NK cell cytolysis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,455,224 N230I possibly damaging Het
4933427D14Rik G T 11: 72,169,783 Q687K probably damaging Het
Actrt2 A G 4: 154,667,412 L89P probably damaging Het
Adamts1 A C 16: 85,802,372 S113R probably benign Het
Agxt2 G T 15: 10,373,862 C118F probably damaging Het
Akap8 G A 17: 32,317,292 T49I probably benign Het
Alk A T 17: 71,869,753 W1519R probably damaging Het
Atf7ip T A 6: 136,559,805 F12Y probably damaging Het
Atp13a5 A G 16: 29,348,740 C131R probably damaging Het
Atp8b4 A G 2: 126,427,363 L168P probably damaging Het
Blm G T 7: 80,505,893 S346* probably null Het
Ccnt2 T G 1: 127,799,445 C199G probably damaging Het
Cd151 A T 7: 141,470,591 H219L probably damaging Het
Cd200r2 A T 16: 44,915,047 R248S probably damaging Het
Cdh3 A G 8: 106,555,446 D822G possibly damaging Het
Clec4b1 T C 6: 123,069,770 probably null Het
Cluh C A 11: 74,665,986 L951I probably benign Het
Cog7 A T 7: 121,963,271 probably null Het
Col25a1 C A 3: 130,476,394 P197Q probably damaging Het
Csde1 T A 3: 103,056,426 S636R possibly damaging Het
Ect2l C A 10: 18,199,940 C66F possibly damaging Het
Elac2 T C 11: 64,999,436 M671T probably benign Het
Evi5 T C 5: 107,821,748 N143S probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fbxo38 A G 18: 62,505,980 Y1084H probably damaging Het
Fcgr4 T A 1: 171,029,191 L209Q probably damaging Het
Fgd3 C T 13: 49,296,524 S83N probably benign Het
Gigyf2 T A 1: 87,421,493 M664K probably benign Het
Gm38394 T C 1: 133,658,734 I288M probably damaging Het
Il27ra A T 8: 84,039,499 S219T probably benign Het
Kif15 T C 9: 122,997,797 V800A probably damaging Het
Lmo7 T A 14: 101,900,560 D666E probably damaging Het
Lrp5 T C 19: 3,628,295 D520G probably damaging Het
Lrriq3 T A 3: 155,188,297 M545K probably benign Het
Lsm5 T A 6: 56,703,325 D44V probably damaging Het
Man1c1 G T 4: 134,569,068 Y430* probably null Het
Map4 T A 9: 110,037,278 probably null Het
Megf6 A G 4: 154,258,941 K561R probably benign Het
Myo1e T C 9: 70,322,398 Y173H probably damaging Het
Myo6 T A 9: 80,283,541 S791R possibly damaging Het
Nol11 C A 11: 107,184,771 E144* probably null Het
Ntng2 C T 2: 29,197,062 R416Q probably damaging Het
Nxpe3 T A 16: 55,866,517 I43F possibly damaging Het
Olfr1093 A T 2: 86,786,347 T206S possibly damaging Het
Olfr1284 T A 2: 111,379,492 V164E possibly damaging Het
Pkd1l2 T C 8: 117,082,260 I64V probably damaging Het
Rest A G 5: 77,281,027 D431G probably damaging Het
Serpina10 A T 12: 103,616,868 L439Q probably damaging Het
Sgk3 T G 1: 9,881,579 V176G probably damaging Het
Slc19a3 A G 1: 83,022,733 S188P probably damaging Het
Sorbs1 A G 19: 40,349,948 I336T probably damaging Het
Ssfa2 A G 2: 79,657,346 D591G probably benign Het
Strip1 C T 3: 107,620,039 probably null Het
Syt4 T C 18: 31,443,746 E185G possibly damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tgfbr3l G T 8: 4,249,439 R74L possibly damaging Het
Thoc7 A G 14: 13,949,282 M194T probably benign Het
Thsd7b T C 1: 129,951,392 Y989H probably damaging Het
Tmem156 C T 5: 65,075,818 V134I probably benign Het
Tnks A T 8: 34,853,303 V738E probably benign Het
Trpm6 A T 19: 18,792,876 I342F probably damaging Het
Vmn2r69 A T 7: 85,411,503 V291D probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wnk1 T C 6: 119,951,992 T1292A probably damaging Het
Yes1 T A 5: 32,655,240 C285S probably benign Het
Zbtb49 T C 5: 38,213,919 N206S probably benign Het
Other mutations in Prf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Prf1 APN 10 61300178 missense probably benign
prime UTSW 10 61303722 nonsense probably null
PIT4802001:Prf1 UTSW 10 61300193 missense probably benign 0.01
R0594:Prf1 UTSW 10 61303722 nonsense probably null
R1237:Prf1 UTSW 10 61303649 missense probably benign 0.00
R1508:Prf1 UTSW 10 61303550 missense probably damaging 1.00
R1553:Prf1 UTSW 10 61303169 missense probably damaging 1.00
R1665:Prf1 UTSW 10 61302887 missense probably benign 0.29
R1716:Prf1 UTSW 10 61300452 missense probably benign 0.01
R1817:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R1818:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R2014:Prf1 UTSW 10 61303895 missense probably benign 0.41
R2307:Prf1 UTSW 10 61303163 missense possibly damaging 0.80
R2901:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R2902:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R4724:Prf1 UTSW 10 61303708 missense probably damaging 1.00
R4781:Prf1 UTSW 10 61300424 missense probably damaging 1.00
R5327:Prf1 UTSW 10 61300258 missense probably benign 0.00
R5850:Prf1 UTSW 10 61300193 missense probably benign 0.00
R5999:Prf1 UTSW 10 61303028 missense probably damaging 1.00
R7356:Prf1 UTSW 10 61303280 missense possibly damaging 0.61
R7508:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
R7714:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
R7716:Prf1 UTSW 10 61300155 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCAGAAGCACAAGTTCGTGCC -3'
(R):5'- ACTGGTCCTGATAGGTCTTCTCAGC -3'

Sequencing Primer
(F):5'- ACAAGTTCGTGCCAGGTG -3'
(R):5'- CTGCAAAATTGGCTACCTTGGAG -3'
Posted On2013-06-12