Incidental Mutation 'R6153:Ddx60'
ID 489391
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DExD/H box helicase 60
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
MMRRC Submission 044300-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R6153 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 62381121-62490735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62398974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 231 (D231G)
Ref Sequence ENSEMBL: ENSMUSP00000122841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]
AlphaFold E9PZQ1
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: D231G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: D231G

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: D231G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: D231G

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000154398
AA Change: D231G

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: D231G

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 99% (66/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,251,259 (GRCm39) probably null Het
Ache T C 5: 137,290,117 (GRCm39) I394T probably damaging Het
Acsm1 G A 7: 119,232,289 (GRCm39) G62D probably damaging Het
Actrt3 T A 3: 30,653,899 (GRCm39) I34F probably damaging Het
Adgrf5 T C 17: 43,761,974 (GRCm39) I1223T possibly damaging Het
Adora2a T C 10: 75,161,981 (GRCm39) F40S possibly damaging Het
Ano8 T C 8: 71,933,441 (GRCm39) probably benign Het
Arid1b T A 17: 5,293,107 (GRCm39) L675Q probably damaging Het
Atg2b T C 12: 105,589,741 (GRCm39) I1837V possibly damaging Het
Atp10b A G 11: 43,145,109 (GRCm39) Y1284C probably damaging Het
B3gnt7 G T 1: 86,233,237 (GRCm39) G44V probably damaging Het
Chrna1 G T 2: 73,403,653 (GRCm39) H99N probably benign Het
Cnksr1 T C 4: 133,961,204 (GRCm39) H220R probably damaging Het
Cpsf2 T A 12: 101,965,619 (GRCm39) probably null Het
Daglb T C 5: 143,489,096 (GRCm39) L651P probably benign Het
Ehd4 A C 2: 119,932,904 (GRCm39) F174C probably damaging Het
Emsy G T 7: 98,260,060 (GRCm39) P9T probably damaging Het
Fnbp1l T C 3: 122,352,805 (GRCm39) E217G probably benign Het
Gm11596 A T 11: 99,683,524 (GRCm39) C199S unknown Het
Gmps T G 3: 63,908,964 (GRCm39) C489G probably benign Het
Gpsm1 T C 2: 26,215,425 (GRCm39) Y296H probably benign Het
Heatr5b T C 17: 79,138,870 (GRCm39) T91A possibly damaging Het
Hs3st3b1 A T 11: 63,780,324 (GRCm39) W268R probably damaging Het
Il27ra T C 8: 84,758,773 (GRCm39) probably null Het
Itga5 T A 15: 103,265,880 (GRCm39) I156F probably damaging Het
Kcnmb3 T A 3: 32,527,976 (GRCm39) D96V probably damaging Het
Khdrbs1 T A 4: 129,609,965 (GRCm39) N417Y probably damaging Het
Loxhd1 A G 18: 77,383,454 (GRCm39) N118D possibly damaging Het
Mdm4 A G 1: 132,919,845 (GRCm39) L341P probably damaging Het
Mecom T C 3: 30,047,797 (GRCm39) E225G possibly damaging Het
Megf8 G A 7: 25,046,796 (GRCm39) G1560S possibly damaging Het
Mfsd13a A T 19: 46,356,321 (GRCm39) D142V probably damaging Het
Muc5b A T 7: 141,415,181 (GRCm39) Y2709F possibly damaging Het
Nelfa A T 5: 34,056,223 (GRCm39) I480N probably damaging Het
Or10ak8 G A 4: 118,773,944 (GRCm39) S240F probably damaging Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Palld G T 8: 62,003,186 (GRCm39) N304K probably damaging Het
Pcsk5 A G 19: 17,488,856 (GRCm39) L988P probably damaging Het
Prmt1 A T 7: 44,631,251 (GRCm39) F34I probably damaging Het
Pzp A G 6: 128,465,979 (GRCm39) S1234P probably benign Het
Ralb A T 1: 119,405,870 (GRCm39) probably null Het
Robo2 T A 16: 73,717,617 (GRCm39) D141V probably damaging Het
Rsrc1 T C 3: 67,262,895 (GRCm39) I283T probably benign Het
Sec62 A T 3: 30,864,631 (GRCm39) K165M unknown Het
Sez6 A G 11: 77,868,648 (GRCm39) D974G probably damaging Het
Shc2 T A 10: 79,465,752 (GRCm39) I187F possibly damaging Het
Shroom3 G A 5: 93,112,267 (GRCm39) R1876Q probably damaging Het
Siglecg C A 7: 43,061,441 (GRCm39) N481K possibly damaging Het
Skil T A 3: 31,152,002 (GRCm39) F175I probably damaging Het
Slc1a1 T C 19: 28,886,935 (GRCm39) V432A probably damaging Het
Slit3 G T 11: 35,591,310 (GRCm39) G1374V possibly damaging Het
Snx14 T C 9: 88,273,859 (GRCm39) Y644C probably damaging Het
Snx33 T A 9: 56,833,983 (GRCm39) I29F possibly damaging Het
Sos1 T A 17: 80,756,764 (GRCm39) I263L probably benign Het
Susd2 C T 10: 75,473,853 (GRCm39) A581T probably damaging Het
Tbpl2 C A 2: 23,966,028 (GRCm39) V320F probably damaging Het
Tmem209 A G 6: 30,505,794 (GRCm39) S171P probably benign Het
Tprkb T A 6: 85,893,172 (GRCm39) probably null Het
Tspan11 G A 6: 127,916,061 (GRCm39) S119N probably benign Het
Ulk2 A T 11: 61,672,572 (GRCm39) V922D probably damaging Het
Zfp267 A G 3: 36,219,303 (GRCm39) H442R possibly damaging Het
Zfp976 A C 7: 42,263,610 (GRCm39) Y76D probably damaging Het
Zkscan2 G A 7: 123,088,993 (GRCm39) T426I probably benign Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 62,411,680 (GRCm39) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 62,440,465 (GRCm39) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 62,422,617 (GRCm39) missense probably benign 0.18
IGL01023:Ddx60 APN 8 62,395,548 (GRCm39) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 62,435,560 (GRCm39) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 62,416,774 (GRCm39) missense probably null 0.81
IGL01733:Ddx60 APN 8 62,436,899 (GRCm39) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,470,857 (GRCm39) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,453,743 (GRCm39) splice site probably benign
IGL02110:Ddx60 APN 8 62,470,281 (GRCm39) critical splice donor site probably null
IGL02302:Ddx60 APN 8 62,428,866 (GRCm39) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 62,411,676 (GRCm39) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,477,985 (GRCm39) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 62,395,470 (GRCm39) splice site probably null
IGL02657:Ddx60 APN 8 62,437,149 (GRCm39) missense probably benign 0.01
IGL02677:Ddx60 APN 8 62,441,166 (GRCm39) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 62,432,375 (GRCm39) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 62,409,156 (GRCm39) missense probably benign 0.00
IGL03137:Ddx60 APN 8 62,441,117 (GRCm39) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 62,409,155 (GRCm39) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,465,483 (GRCm39) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 62,430,916 (GRCm39) critical splice acceptor site probably null
Scatter UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
shotgun UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
splay UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 62,411,147 (GRCm39) missense probably benign
PIT4677001:Ddx60 UTSW 8 62,425,288 (GRCm39) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 62,395,327 (GRCm39) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,486,527 (GRCm39) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 62,436,889 (GRCm39) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,470,783 (GRCm39) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 62,447,575 (GRCm39) splice site probably benign
R0479:Ddx60 UTSW 8 62,422,691 (GRCm39) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,470,828 (GRCm39) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 62,440,395 (GRCm39) missense probably benign 0.27
R1119:Ddx60 UTSW 8 62,395,578 (GRCm39) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 62,411,193 (GRCm39) splice site probably benign
R1778:Ddx60 UTSW 8 62,427,210 (GRCm39) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 62,422,587 (GRCm39) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 62,401,903 (GRCm39) missense probably benign 0.10
R1970:Ddx60 UTSW 8 62,425,240 (GRCm39) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 62,393,679 (GRCm39) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,470,234 (GRCm39) missense probably benign 0.01
R2174:Ddx60 UTSW 8 62,409,175 (GRCm39) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 62,411,097 (GRCm39) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,490,125 (GRCm39) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,465,470 (GRCm39) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,490,122 (GRCm39) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 62,409,178 (GRCm39) missense probably benign 0.25
R4010:Ddx60 UTSW 8 62,407,569 (GRCm39) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 62,425,254 (GRCm39) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 62,447,427 (GRCm39) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 62,402,012 (GRCm39) splice site probably null
R4561:Ddx60 UTSW 8 62,395,495 (GRCm39) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 62,440,455 (GRCm39) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,476,295 (GRCm39) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,465,458 (GRCm39) missense probably benign 0.01
R4807:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 62,398,940 (GRCm39) missense probably benign 0.01
R5187:Ddx60 UTSW 8 62,427,222 (GRCm39) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 62,437,192 (GRCm39) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,463,036 (GRCm39) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 62,403,485 (GRCm39) missense probably benign 0.28
R5514:Ddx60 UTSW 8 62,411,091 (GRCm39) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,453,612 (GRCm39) missense probably benign 0.38
R5742:Ddx60 UTSW 8 62,401,955 (GRCm39) missense probably benign
R5772:Ddx60 UTSW 8 62,401,931 (GRCm39) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,465,422 (GRCm39) nonsense probably null
R5815:Ddx60 UTSW 8 62,416,756 (GRCm39) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 62,409,155 (GRCm39) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 62,393,774 (GRCm39) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,474,444 (GRCm39) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,453,616 (GRCm39) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,476,275 (GRCm39) missense probably null 0.01
R6287:Ddx60 UTSW 8 62,403,612 (GRCm39) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 62,436,939 (GRCm39) missense probably benign 0.00
R6416:Ddx60 UTSW 8 62,451,715 (GRCm39) missense probably benign
R6416:Ddx60 UTSW 8 62,430,984 (GRCm39) missense probably benign 0.00
R6660:Ddx60 UTSW 8 62,409,273 (GRCm39) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 62,436,924 (GRCm39) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,453,723 (GRCm39) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,490,103 (GRCm39) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 62,441,142 (GRCm39) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R7409:Ddx60 UTSW 8 62,411,612 (GRCm39) missense probably benign 0.24
R7464:Ddx60 UTSW 8 62,393,708 (GRCm39) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 62,428,826 (GRCm39) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 62,430,924 (GRCm39) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 62,407,569 (GRCm39) missense probably benign 0.03
R8124:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8125:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8126:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8155:Ddx60 UTSW 8 62,470,205 (GRCm39) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,470,284 (GRCm39) splice site probably null
R8192:Ddx60 UTSW 8 62,431,002 (GRCm39) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
R8304:Ddx60 UTSW 8 62,451,803 (GRCm39) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 62,395,669 (GRCm39) critical splice donor site probably null
R8374:Ddx60 UTSW 8 62,427,205 (GRCm39) missense probably benign 0.01
R8401:Ddx60 UTSW 8 62,409,277 (GRCm39) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 62,427,184 (GRCm39) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 62,411,640 (GRCm39) missense probably benign 0.27
R8826:Ddx60 UTSW 8 62,398,990 (GRCm39) missense probably benign 0.02
R8829:Ddx60 UTSW 8 62,393,695 (GRCm39) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 62,447,553 (GRCm39) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 62,427,168 (GRCm39) nonsense probably null
R9122:Ddx60 UTSW 8 62,442,898 (GRCm39) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,470,875 (GRCm39) missense probably benign 0.36
R9278:Ddx60 UTSW 8 62,431,012 (GRCm39) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,462,994 (GRCm39) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 62,425,248 (GRCm39) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,465,312 (GRCm39) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,486,451 (GRCm39) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 62,416,726 (GRCm39) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,453,622 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGAGAACTGCTTTGTAACGTGAG -3'
(R):5'- AAACCCTGGAAGATGGCTG -3'

Sequencing Primer
(F):5'- ACGTGAGTTTACCTTAAATTTCTGAG -3'
(R):5'- CCTGGAAGATGGCTGGTCTCAAG -3'
Posted On 2017-10-10