Incidental Mutation 'R6153:Shc2'
ID489400
Institutional Source Beutler Lab
Gene Symbol Shc2
Ensembl Gene ENSMUSG00000020312
Gene NameSHC (Src homology 2 domain containing) transforming protein 2
SynonymsShcB, Sli
MMRRC Submission 044300-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6153 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79618051-79637918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79629918 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 187 (I187F)
Ref Sequence ENSEMBL: ENSMUSP00000020564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020564
AA Change: I187F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020564
Gene: ENSMUSG00000020312
AA Change: I187F

DomainStartEndE-ValueType
PTB 1 154 4.43e-24 SMART
low complexity region 172 178 N/A INTRINSIC
SH2 341 420 5.81e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163867
AA Change: I187F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129491
Gene: ENSMUSG00000020312
AA Change: I187F

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
PTB 126 289 7.41e-35 SMART
low complexity region 307 313 N/A INTRINSIC
SH2 476 555 5.81e-29 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 99% (66/67)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display sensory nerve defects related to nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,301,259 probably null Het
Ache T C 5: 137,291,855 I394T probably damaging Het
Acsm1 G A 7: 119,633,066 G62D probably damaging Het
Actrt3 T A 3: 30,599,750 I34F probably damaging Het
Adgrf5 T C 17: 43,451,083 I1223T possibly damaging Het
Adora2a T C 10: 75,326,147 F40S possibly damaging Het
Ano8 T C 8: 71,480,797 probably benign Het
Arid1b T A 17: 5,242,832 L675Q probably damaging Het
Atg2b T C 12: 105,623,482 I1837V possibly damaging Het
Atp10b A G 11: 43,254,282 Y1284C probably damaging Het
B3gnt7 G T 1: 86,305,515 G44V probably damaging Het
Chrna1 G T 2: 73,573,309 H99N probably benign Het
Cnksr1 T C 4: 134,233,893 H220R probably damaging Het
Cpsf2 T A 12: 101,999,360 probably null Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Daglb T C 5: 143,503,341 L651P probably benign Het
Ddx60 A G 8: 61,945,940 D231G possibly damaging Het
Ehd4 A C 2: 120,102,423 F174C probably damaging Het
Emsy G T 7: 98,610,853 P9T probably damaging Het
Fnbp1l T C 3: 122,559,156 E217G probably benign Het
Gm11596 A T 11: 99,792,698 C199S unknown Het
Gmps T G 3: 64,001,543 C489G probably benign Het
Gpsm1 T C 2: 26,325,413 Y296H probably benign Het
Heatr5b T C 17: 78,831,441 T91A possibly damaging Het
Hs3st3b1 A T 11: 63,889,498 W268R probably damaging Het
Il27ra T C 8: 84,032,144 probably null Het
Itga5 T A 15: 103,357,453 I156F probably damaging Het
Kcnmb3 T A 3: 32,473,827 D96V probably damaging Het
Khdrbs1 T A 4: 129,716,172 N417Y probably damaging Het
Loxhd1 A G 18: 77,295,758 N118D possibly damaging Het
Mdm4 A G 1: 132,992,107 L341P probably damaging Het
Mecom T C 3: 29,993,648 E225G possibly damaging Het
Megf8 G A 7: 25,347,371 G1560S possibly damaging Het
Mfsd13a A T 19: 46,367,882 D142V probably damaging Het
Muc5b A T 7: 141,861,444 Y2709F possibly damaging Het
Nelfa A T 5: 33,898,879 I480N probably damaging Het
Olfr1329 G A 4: 118,916,747 S240F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Palld G T 8: 61,550,152 N304K probably damaging Het
Pcsk5 A G 19: 17,511,492 L988P probably damaging Het
Prmt1 A T 7: 44,981,827 F34I probably damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Ralb A T 1: 119,478,140 probably null Het
Robo2 T A 16: 73,920,729 D141V probably damaging Het
Rsrc1 T C 3: 67,355,562 I283T probably benign Het
Sec62 A T 3: 30,810,482 K165M unknown Het
Sez6 A G 11: 77,977,822 D974G probably damaging Het
Shroom3 G A 5: 92,964,408 R1876Q probably damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Skil T A 3: 31,097,853 F175I probably damaging Het
Slc1a1 T C 19: 28,909,535 V432A probably damaging Het
Slit3 G T 11: 35,700,483 G1374V possibly damaging Het
Snx14 T C 9: 88,391,806 Y644C probably damaging Het
Snx33 T A 9: 56,926,699 I29F possibly damaging Het
Sos1 T A 17: 80,449,335 I263L probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tbpl2 C A 2: 24,076,016 V320F probably damaging Het
Tmem209 A G 6: 30,505,795 S171P probably benign Het
Tprkb T A 6: 85,916,190 probably null Het
Tspan11 G A 6: 127,939,098 S119N probably benign Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Zfp976 A C 7: 42,614,186 Y76D probably damaging Het
Zkscan2 G A 7: 123,489,770 T426I probably benign Het
Other mutations in Shc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Shc2 APN 10 79621069 missense probably damaging 1.00
IGL01586:Shc2 APN 10 79622304 missense probably damaging 0.99
IGL01965:Shc2 APN 10 79627189 splice site probably benign
IGL02149:Shc2 APN 10 79622268 missense probably damaging 1.00
IGL02252:Shc2 APN 10 79626370 missense probably benign 0.00
shrine UTSW 10 79629917 missense probably damaging 0.99
R0538:Shc2 UTSW 10 79630140 splice site probably benign
R0630:Shc2 UTSW 10 79626141 unclassified probably null
R0894:Shc2 UTSW 10 79629917 missense probably damaging 0.99
R1166:Shc2 UTSW 10 79621112 missense probably damaging 1.00
R1339:Shc2 UTSW 10 79626416 missense probably benign 0.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1647:Shc2 UTSW 10 79626111 missense probably benign
R1648:Shc2 UTSW 10 79626111 missense probably benign
R1959:Shc2 UTSW 10 79626791 unclassified probably null
R3800:Shc2 UTSW 10 79626873 missense probably benign 0.40
R4603:Shc2 UTSW 10 79623856 missense probably benign 0.03
R4635:Shc2 UTSW 10 79626286 missense probably benign 0.35
R4656:Shc2 UTSW 10 79621169 missense probably damaging 1.00
R4715:Shc2 UTSW 10 79622379 missense probably benign 0.01
R4841:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R4842:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R5057:Shc2 UTSW 10 79623872 missense probably benign 0.01
R5394:Shc2 UTSW 10 79630099 missense probably damaging 1.00
R6160:Shc2 UTSW 10 79627019 critical splice donor site probably null
R6178:Shc2 UTSW 10 79630120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCAAAGGTGGACTGTG -3'
(R):5'- GATCTCATTCTCCCACAGGG -3'

Sequencing Primer
(F):5'- CAAAGGTGGACTGTGGGTGAG -3'
(R):5'- CATCAATCGGCTCCATGAGG -3'
Posted On2017-10-10