Incidental Mutation 'R6153:Hs3st3b1'
ID489405
Institutional Source Beutler Lab
Gene Symbol Hs3st3b1
Ensembl Gene ENSMUSG00000070407
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Synonyms3OST3B1, m3-OST-3B, 3-OST-3B, HS3ST3B1, 3Ost3b
MMRRC Submission 044300-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6153 (G1)
Quality Score113.008
Status Not validated
Chromosome11
Chromosomal Location63885792-63922290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63889498 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 268 (W268R)
Ref Sequence ENSEMBL: ENSMUSP00000091647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094103]
Predicted Effect probably damaging
Transcript: ENSMUST00000094103
AA Change: W268R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091647
Gene: ENSMUSG00000070407
AA Change: W268R

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 6 318 1.7e-11 PFAM
Pfam:Sulfotransfer_1 137 383 6.3e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II integral membrane protein that belongs to the 3-O-sulfotransferases family. These proteins catalyze the addition of sulfate groups at the 3-OH position of glucosamine in heparan sulfate. The substrate specificity of individual members of the family is based on prior modification of the heparan sulfate chain, thus allowing different members of the family to generate binding sites for different proteins on the same heparan sulfate chain. Following treatment with a histone deacetylase inhibitor, expression of this gene is activated in a pancreatic cell line. The increased expression results in promotion of the epithelial-mesenchymal transition. In addition, the modification catalyzed by this protein allows herpes simplex virus membrane fusion and penetration. A very closely related homolog with an almost identical sulfotransferase domain maps less than 1 Mb away. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,301,259 probably null Het
Ache T C 5: 137,291,855 I394T probably damaging Het
Acsm1 G A 7: 119,633,066 G62D probably damaging Het
Actrt3 T A 3: 30,599,750 I34F probably damaging Het
Adgrf5 T C 17: 43,451,083 I1223T possibly damaging Het
Adora2a T C 10: 75,326,147 F40S possibly damaging Het
Ano8 T C 8: 71,480,797 probably benign Het
Arid1b T A 17: 5,242,832 L675Q probably damaging Het
Atg2b T C 12: 105,623,482 I1837V possibly damaging Het
Atp10b A G 11: 43,254,282 Y1284C probably damaging Het
B3gnt7 G T 1: 86,305,515 G44V probably damaging Het
Chrna1 G T 2: 73,573,309 H99N probably benign Het
Cnksr1 T C 4: 134,233,893 H220R probably damaging Het
Cpsf2 T A 12: 101,999,360 probably null Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Daglb T C 5: 143,503,341 L651P probably benign Het
Ddx60 A G 8: 61,945,940 D231G possibly damaging Het
Ehd4 A C 2: 120,102,423 F174C probably damaging Het
Emsy G T 7: 98,610,853 P9T probably damaging Het
Fnbp1l T C 3: 122,559,156 E217G probably benign Het
Gm11596 A T 11: 99,792,698 C199S unknown Het
Gmps T G 3: 64,001,543 C489G probably benign Het
Gpsm1 T C 2: 26,325,413 Y296H probably benign Het
Heatr5b T C 17: 78,831,441 T91A possibly damaging Het
Il27ra T C 8: 84,032,144 probably null Het
Itga5 T A 15: 103,357,453 I156F probably damaging Het
Kcnmb3 T A 3: 32,473,827 D96V probably damaging Het
Khdrbs1 T A 4: 129,716,172 N417Y probably damaging Het
Loxhd1 A G 18: 77,295,758 N118D possibly damaging Het
Mdm4 A G 1: 132,992,107 L341P probably damaging Het
Mecom T C 3: 29,993,648 E225G possibly damaging Het
Megf8 G A 7: 25,347,371 G1560S possibly damaging Het
Mfsd13a A T 19: 46,367,882 D142V probably damaging Het
Muc5b A T 7: 141,861,444 Y2709F possibly damaging Het
Nelfa A T 5: 33,898,879 I480N probably damaging Het
Olfr1329 G A 4: 118,916,747 S240F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Palld G T 8: 61,550,152 N304K probably damaging Het
Pcsk5 A G 19: 17,511,492 L988P probably damaging Het
Prmt1 A T 7: 44,981,827 F34I probably damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Ralb A T 1: 119,478,140 probably null Het
Robo2 T A 16: 73,920,729 D141V probably damaging Het
Rsrc1 T C 3: 67,355,562 I283T probably benign Het
Sec62 A T 3: 30,810,482 K165M unknown Het
Sez6 A G 11: 77,977,822 D974G probably damaging Het
Shc2 T A 10: 79,629,918 I187F possibly damaging Het
Shroom3 G A 5: 92,964,408 R1876Q probably damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Skil T A 3: 31,097,853 F175I probably damaging Het
Slc1a1 T C 19: 28,909,535 V432A probably damaging Het
Slit3 G T 11: 35,700,483 G1374V possibly damaging Het
Snx14 T C 9: 88,391,806 Y644C probably damaging Het
Snx33 T A 9: 56,926,699 I29F possibly damaging Het
Sos1 T A 17: 80,449,335 I263L probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tbpl2 C A 2: 24,076,016 V320F probably damaging Het
Tmem209 A G 6: 30,505,795 S171P probably benign Het
Tprkb T A 6: 85,916,190 probably null Het
Tspan11 G A 6: 127,939,098 S119N probably benign Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Zfp976 A C 7: 42,614,186 Y76D probably damaging Het
Zkscan2 G A 7: 123,489,770 T426I probably benign Het
Other mutations in Hs3st3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0723:Hs3st3b1 UTSW 11 63921575 missense probably benign
R1940:Hs3st3b1 UTSW 11 63889743 missense probably benign 0.01
R2386:Hs3st3b1 UTSW 11 63889213 nonsense probably null
R4784:Hs3st3b1 UTSW 11 63889260 missense probably benign 0.21
R5771:Hs3st3b1 UTSW 11 63889272 missense probably benign 0.00
R6102:Hs3st3b1 UTSW 11 63921855 nonsense probably null
R6191:Hs3st3b1 UTSW 11 63889203 missense probably benign 0.00
R6525:Hs3st3b1 UTSW 11 63921598 missense probably benign
R7282:Hs3st3b1 UTSW 11 63921571 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCCTTGGTCTGGTTGAAG -3'
(R):5'- AAGACGCCCAGCTACTTTGTG -3'

Sequencing Primer
(F):5'- CCCTTGGTCTGGTTGAAGTAGAAG -3'
(R):5'- AGCTACTTTGTGACCCGGGAG -3'
Posted On2017-10-10