Mutagenetix > Incidental Mutations

Incidental Mutation 'R6153:Robo2'

489411

Institutional Source

Beutler Lab

Gene Symbol

Robo2

Ensembl Gene

ENSMUSG00000052516

Gene Name

roundabout guidance receptor 2

Synonyms

9430089E08Rik, 2600013A04Rik, D230004I22Rik

MMRRC Submission

044300-MU

Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene?

Probably essential (E-score: 0.944) question?

Stock #

R6153 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73891839-74411825 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73920729 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 141 (D141V)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000138852] [ENSMUST00000226478]

Predicted Effect

probably damaging
Transcript: ENSMUST00000116586
AA Change: D141V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: D141V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	330	402	1.3e-11	SMART
IGc2	434	499	3.73e-12	SMART
FN3	526	608	1.42e-15	SMART
FN3	640	725	3.54e-2	SMART
FN3	740	827	6.15e-11	SMART
transmembrane domain	864	886	N/A	INTRINSIC
low complexity region	1044	1069	N/A	INTRINSIC
low complexity region	1076	1087	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117200
AA Change: D1119V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: D1119V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1040	1065	N/A	INTRINSIC
low complexity region	1072	1083	N/A	INTRINSIC
low complexity region	1191	1199	N/A	INTRINSIC
low complexity region	1210	1234	N/A	INTRINSIC
low complexity region	1318	1342	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117785
AA Change: D1161V

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: D1161V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1072	1107	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1233	1241	N/A	INTRINSIC
low complexity region	1252	1276	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
low complexity region	1451	1475	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138852
AA Change: D84V

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000226478
AA Change: D1165V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000231426

Predicted Effect

unknown
Transcript: ENSMUST00000231889
AA Change: D445V

Meta Mutation Damage Score

0.0816

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.3%

Validation Efficiency

99% (66/67)

MGI Phenotype

Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	T	11: 9,301,259		probably null	Het
Ache	T	C	5: 137,291,855	I394T	probably damaging	Het
Acsm1	G	A	7: 119,633,066	G62D	probably damaging	Het
Actrt3	T	A	3: 30,599,750	I34F	probably damaging	Het
Adgrf5	T	C	17: 43,451,083	I1223T	possibly damaging	Het
Adora2a	T	C	10: 75,326,147	F40S	possibly damaging	Het
Ano8	T	C	8: 71,480,797		probably benign	Het
Arid1b	T	A	17: 5,242,832	L675Q	probably damaging	Het
Atg2b	T	C	12: 105,623,482	I1837V	possibly damaging	Het
Atp10b	A	G	11: 43,254,282	Y1284C	probably damaging	Het
B3gnt7	G	T	1: 86,305,515	G44V	probably damaging	Het
Chrna1	G	T	2: 73,573,309	H99N	probably benign	Het
Cnksr1	T	C	4: 134,233,893	H220R	probably damaging	Het
Cpsf2	T	A	12: 101,999,360		probably null	Het
D3Ertd254e	A	G	3: 36,165,154	H442R	possibly damaging	Het
Daglb	T	C	5: 143,503,341	L651P	probably benign	Het
Ddx60	A	G	8: 61,945,940	D231G	possibly damaging	Het
Ehd4	A	C	2: 120,102,423	F174C	probably damaging	Het
Emsy	G	T	7: 98,610,853	P9T	probably damaging	Het
Fnbp1l	T	C	3: 122,559,156	E217G	probably benign	Het
Gm11596	A	T	11: 99,792,698	C199S	unknown	Het
Gmps	T	G	3: 64,001,543	C489G	probably benign	Het
Gpsm1	T	C	2: 26,325,413	Y296H	probably benign	Het
Heatr5b	T	C	17: 78,831,441	T91A	possibly damaging	Het
Hs3st3b1	A	T	11: 63,889,498	W268R	probably damaging	Het
Il27ra	T	C	8: 84,032,144		probably null	Het
Itga5	T	A	15: 103,357,453	I156F	probably damaging	Het
Kcnmb3	T	A	3: 32,473,827	D96V	probably damaging	Het
Khdrbs1	T	A	4: 129,716,172	N417Y	probably damaging	Het
Loxhd1	A	G	18: 77,295,758	N118D	possibly damaging	Het
Mdm4	A	G	1: 132,992,107	L341P	probably damaging	Het
Mecom	T	C	3: 29,993,648	E225G	possibly damaging	Het
Megf8	G	A	7: 25,347,371	G1560S	possibly damaging	Het
Mfsd13a	A	T	19: 46,367,882	D142V	probably damaging	Het
Muc5b	A	T	7: 141,861,444	Y2709F	possibly damaging	Het
Nelfa	A	T	5: 33,898,879	I480N	probably damaging	Het
Olfr1329	G	A	4: 118,916,747	S240F	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Palld	G	T	8: 61,550,152	N304K	probably damaging	Het
Pcsk5	A	G	19: 17,511,492	L988P	probably damaging	Het
Prmt1	A	T	7: 44,981,827	F34I	probably damaging	Het
Pzp	A	G	6: 128,489,016	S1234P	probably benign	Het
Ralb	A	T	1: 119,478,140		probably null	Het
Rsrc1	T	C	3: 67,355,562	I283T	probably benign	Het
Sec62	A	T	3: 30,810,482	K165M	unknown	Het
Sez6	A	G	11: 77,977,822	D974G	probably damaging	Het
Shc2	T	A	10: 79,629,918	I187F	possibly damaging	Het
Shroom3	G	A	5: 92,964,408	R1876Q	probably damaging	Het
Siglecg	C	A	7: 43,412,017	N481K	possibly damaging	Het
Skil	T	A	3: 31,097,853	F175I	probably damaging	Het
Slc1a1	T	C	19: 28,909,535	V432A	probably damaging	Het
Slit3	G	T	11: 35,700,483	G1374V	possibly damaging	Het
Snx14	T	C	9: 88,391,806	Y644C	probably damaging	Het
Snx33	T	A	9: 56,926,699	I29F	possibly damaging	Het
Sos1	T	A	17: 80,449,335	I263L	probably benign	Het
Susd2	C	T	10: 75,638,019	A581T	probably damaging	Het
Tbpl2	C	A	2: 24,076,016	V320F	probably damaging	Het
Tmem209	A	G	6: 30,505,795	S171P	probably benign	Het
Tprkb	T	A	6: 85,916,190		probably null	Het
Tspan11	G	A	6: 127,939,098	S119N	probably benign	Het
Ulk2	A	T	11: 61,781,746	V922D	probably damaging	Het
Zfp976	A	C	7: 42,614,186	Y76D	probably damaging	Het
Zkscan2	G	A	7: 123,489,770	T426I	probably benign	Het

Other mutations in Robo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Robo2	APN	16	73961700	missense	probably benign
IGL00849:Robo2	APN	16	73973777	missense	possibly damaging	0.80
IGL00908:Robo2	APN	16	73985691	missense	probably damaging	0.98
IGL00944:Robo2	APN	16	73933697	missense	possibly damaging	0.92
IGL00955:Robo2	APN	16	74015972	missense	probably damaging	1.00
IGL00970:Robo2	APN	16	73897046	missense	probably benign	0.00
IGL01020:Robo2	APN	16	73928151	missense	probably benign	0.06
IGL01347:Robo2	APN	16	74352856	missense	probably damaging	1.00
IGL02280:Robo2	APN	16	74046816	missense	probably damaging	1.00
IGL02424:Robo2	APN	16	73973301	missense	possibly damaging	0.89
IGL03376:Robo2	APN	16	73956492	missense	probably damaging	1.00
LCD18:Robo2	UTSW	16	74055954	intron	probably benign
P0018:Robo2	UTSW	16	74046806	missense	possibly damaging	0.82
R0314:Robo2	UTSW	16	73956637	missense	probably damaging	1.00
R0324:Robo2	UTSW	16	73967851	missense	probably damaging	1.00
R0539:Robo2	UTSW	16	73985574	splice site	probably benign
R0620:Robo2	UTSW	16	73967802	missense	possibly damaging	0.92
R0630:Robo2	UTSW	16	73916205	missense	probably benign	0.05
R0701:Robo2	UTSW	16	74046874	missense	probably damaging	1.00
R1155:Robo2	UTSW	16	74035108	missense	probably damaging	1.00
R1168:Robo2	UTSW	16	73948296	missense	probably damaging	1.00
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1317:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1422:Robo2	UTSW	16	73978448	missense	probably damaging	0.99
R1452:Robo2	UTSW	16	73961910	missense	probably damaging	1.00
R1649:Robo2	UTSW	16	73899001	missense	probably benign	0.36
R1709:Robo2	UTSW	16	73956523	missense	possibly damaging	0.83
R1751:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1761:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1885:Robo2	UTSW	16	73916145	missense	probably benign	0.00
R1911:Robo2	UTSW	16	73958325	missense	probably damaging	1.00
R1919:Robo2	UTSW	16	73899154	missense	probably benign
R2005:Robo2	UTSW	16	73933115	missense	possibly damaging	0.82
R2851:Robo2	UTSW	16	73961888	missense	probably damaging	1.00
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3733:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3734:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3913:Robo2	UTSW	16	74035005	missense	probably damaging	1.00
R3956:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R4394:Robo2	UTSW	16	73948379	missense	probably benign	0.13
R4426:Robo2	UTSW	16	73948266	missense	probably damaging	1.00
R4437:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R4454:Robo2	UTSW	16	74352519	intron	probably benign
R4478:Robo2	UTSW	16	74015873	missense	probably damaging	1.00
R4586:Robo2	UTSW	16	73961873	missense	probably damaging	0.96
R4621:Robo2	UTSW	16	73985933	missense	probably benign	0.00
R4673:Robo2	UTSW	16	73904378	splice site	probably null
R4798:Robo2	UTSW	16	74352745	missense	probably damaging	1.00
R4812:Robo2	UTSW	16	73916288	missense	probably benign	0.00
R4855:Robo2	UTSW	16	73971191	missense	probably damaging	1.00
R4910:Robo2	UTSW	16	73933778	missense	probably damaging	0.99
R4916:Robo2	UTSW	16	73898915	missense	possibly damaging	0.53
R4948:Robo2	UTSW	16	74352838	missense	possibly damaging	0.88
R5325:Robo2	UTSW	16	73973785	missense	possibly damaging	0.72
R5326:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5447:Robo2	UTSW	16	73973766	nonsense	probably null
R5542:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5545:Robo2	UTSW	16	73961747	missense	probably damaging	1.00
R5646:Robo2	UTSW	16	73961819	missense	probably damaging	0.99
R5734:Robo2	UTSW	16	74352784	missense	probably damaging	1.00
R5892:Robo2	UTSW	16	73895780	utr 3 prime	probably benign
R5960:Robo2	UTSW	16	73933715	missense	probably damaging	1.00
R6126:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6130:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6240:Robo2	UTSW	16	73982139	missense	probably damaging	1.00
R6247:Robo2	UTSW	16	73967784	missense	probably damaging	1.00
R6304:Robo2	UTSW	16	73958308	missense	probably damaging	1.00
R6337:Robo2	UTSW	16	73928151	missense	probably benign	0.06
R6431:Robo2	UTSW	16	74046809	nonsense	probably null
R6440:Robo2	UTSW	16	73916122	missense	probably benign	0.31
R6596:Robo2	UTSW	16	73971108	missense	probably damaging	1.00
R6919:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R6927:Robo2	UTSW	16	73982058	missense	probably damaging	1.00
R7029:Robo2	UTSW	16	73948337	missense	probably damaging	1.00
R7078:Robo2	UTSW	16	74352616	missense	probably damaging	1.00
R7092:Robo2	UTSW	16	73956643	missense	probably damaging	0.99
R7136:Robo2	UTSW	16	73956550	missense	probably damaging	0.99
R7192:Robo2	UTSW	16	73920750	missense	probably benign	0.19
R7569:Robo2	UTSW	16	74035115	missense	possibly damaging	0.82
R7686:Robo2	UTSW	16	73958405	missense	probably damaging	1.00
R7720:Robo2	UTSW	16	73897015	missense	probably benign	0.00
R7772:Robo2	UTSW	16	73961889	missense	probably benign	0.24
R7822:Robo2	UTSW	16	73973171	missense	probably damaging	1.00
R7849:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R7881:Robo2	UTSW	16	73920697	missense	probably benign	0.00
R7897:Robo2	UTSW	16	73898950	missense	probably benign
R8135:Robo2	UTSW	16	73933160	missense	probably benign	0.04
R8297:Robo2	UTSW	16	74015926	nonsense	probably null
R8307:Robo2	UTSW	16	73956610	missense	probably damaging	1.00
R8379:Robo2	UTSW	16	73933700	missense	probably damaging	0.99
R8393:Robo2	UTSW	16	73978494	missense	probably damaging	1.00
R8474:Robo2	UTSW	16	73948262	missense	probably damaging	1.00
R8500:Robo2	UTSW	16	73948340	missense	probably damaging	1.00
X0063:Robo2	UTSW	16	74045828	missense	probably damaging	1.00
Z1176:Robo2	UTSW	16	73933591	missense	probably benign	0.35
Z1177:Robo2	UTSW	16	73940299	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTATATCAAACTGATAGGCCC -3'
(R):5'- CAGATGACTTCCTATGCCATCATC -3'

Sequencing Primer
(F):5'- ATCAAACTGATAGGCCCTTGTC -3'
(R):5'- TGATAAGGAAGACAAACTGAGGAACC -3'

Posted On

2017-10-10