Incidental Mutation 'R6154:Tpr'
ID489425
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
MMRRC Submission 044301-MU
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6154 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150423816 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1146 (V1146E)
Ref Sequence ENSEMBL: ENSMUSP00000112606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect probably benign
Transcript: ENSMUST00000119161
AA Change: V1146E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: V1146E

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124973
AA Change: V1220E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: V1220E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132522
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T G 10: 107,123,349 I79L probably benign Het
Adam6a C T 12: 113,545,672 T555I probably benign Het
Adap1 A G 5: 139,307,776 V60A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Angpt1 T C 15: 42,523,655 E101G probably damaging Het
Asxl2 T C 12: 3,496,593 V459A possibly damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Camta2 G A 11: 70,678,385 A578V probably damaging Het
Cdc16 A G 8: 13,768,609 N316D possibly damaging Het
Chrm3 T A 13: 9,878,440 M187L possibly damaging Het
Clcn4 T C 7: 7,291,482 T367A probably benign Het
Clcn7 T C 17: 25,157,954 S654P probably damaging Het
Col6a3 T A 1: 90,773,665 T2510S unknown Het
Crisp4 T C 1: 18,122,788 E192G possibly damaging Het
Dmbt1 T A 7: 131,109,641 probably null Het
Dnah5 T G 15: 28,204,031 L18R probably benign Het
Dnah9 T G 11: 65,855,338 D3983A probably benign Het
Dock5 C A 14: 67,859,912 V71L probably benign Het
Dync1h1 T C 12: 110,617,993 V610A probably damaging Het
Dynlrb2 A G 8: 116,515,689 Y86C probably benign Het
Ep400 T C 5: 110,755,933 I267V probably damaging Het
Gaa A G 11: 119,278,352 Y575C probably damaging Het
Gm8094 T A 14: 43,076,563 D24V probably benign Het
Gm884 A G 11: 103,614,143 V2333A probably benign Het
Grina T C 15: 76,248,887 I244T possibly damaging Het
Haus6 A G 4: 86,583,756 L626P possibly damaging Het
Hexdc A T 11: 121,221,271 H439L probably benign Het
Ifna12 A T 4: 88,603,294 C5* probably null Het
Igf2bp2 G T 16: 22,076,093 S300* probably null Het
Ighv6-5 T C 12: 114,416,742 R71G probably benign Het
Lrrn4cl T C 19: 8,851,888 S77P probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mink1 T C 11: 70,610,101 V831A possibly damaging Het
Mme T A 3: 63,300,253 I40N probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Ncbp3 T A 11: 73,049,874 Y67N probably damaging Het
Nedd1 T A 10: 92,698,242 I349F possibly damaging Het
Nek11 A T 9: 105,323,169 *81K probably null Het
Nrip1 A G 16: 76,293,830 Y280H probably damaging Het
Obsl1 T C 1: 75,500,144 D722G probably benign Het
Olfr1117-ps1 T G 2: 87,309,558 S256R probably benign Het
Olfr1209 A G 2: 88,910,390 M1T probably null Het
Olfr152 A G 2: 87,782,756 D72G possibly damaging Het
Olfr164 A T 16: 19,286,431 I104K probably damaging Het
Olfr789 C T 10: 129,487,676 T222I probably damaging Het
Pcdhb6 A G 18: 37,334,913 I296V probably benign Het
Pcnx2 G T 8: 125,762,813 L1681M probably damaging Het
Pdlim5 T C 3: 142,277,913 R360G possibly damaging Het
Peli2 C T 14: 48,250,594 Q81* probably null Het
Pitpnb C T 5: 111,338,397 Q56* probably null Het
Ppp1r3a A G 6: 14,754,604 S215P possibly damaging Het
Prrt3 A G 6: 113,495,028 Y728H probably damaging Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sbno1 T C 5: 124,378,479 H1277R possibly damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Sirt6 C T 10: 81,626,505 G20D probably damaging Het
Sit1 C A 4: 43,482,981 R89S probably benign Het
Slc7a12 A G 3: 14,481,034 R80G probably damaging Het
Smok3c T A 5: 138,064,485 M78K probably benign Het
Stk10 T A 11: 32,603,654 probably null Het
Tada2b A G 5: 36,476,664 V190A probably damaging Het
Tnk1 C T 11: 69,856,954 V41I probably damaging Het
Trappc9 T C 15: 73,058,081 D142G probably benign Het
Trpm3 T C 19: 22,987,814 Y1558H probably damaging Het
Unc5c C A 3: 141,678,153 S97R probably damaging Het
Vmn1r172 T C 7: 23,660,158 I156T probably damaging Het
Vmn2r51 A T 7: 10,087,994 M588K possibly damaging Het
Vps26a T G 10: 62,468,340 E117D probably damaging Het
Zfp451 A T 1: 33,803,546 probably benign Het
Zfp534 C A 4: 147,674,688 R508I probably benign Het
Zp3r C T 1: 130,598,905 C187Y probably damaging Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 intron probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
R7751:Tpr UTSW 1 150419895 missense probably benign 0.17
R7804:Tpr UTSW 1 150432559 missense probably damaging 0.99
R7878:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R7961:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R8013:Tpr UTSW 1 150398608 missense probably benign
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Z1177:Tpr UTSW 1 150428235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAAAGCAGAATCCCAGTTG -3'
(R):5'- GTGCCTTCCTCATTACTGGG -3'

Sequencing Primer
(F):5'- CAGTTGTTGGAATGTAAAGCATCTTG -3'
(R):5'- TCATTACTGGGCCACTGTAAG -3'
Posted On2017-10-10