Incidental Mutation 'R6154:Vmn2r51'
ID 489446
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 044301-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6154 (G1)
Quality Score 142.008
Status Not validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9821921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 588 (M588K)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect possibly damaging
Transcript: ENSMUST00000094863
AA Change: M588K

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: M588K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T G 10: 106,959,210 (GRCm39) I79L probably benign Het
Adam6a C T 12: 113,509,292 (GRCm39) T555I probably benign Het
Adap1 A G 5: 139,293,531 (GRCm39) V60A possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Angpt1 T C 15: 42,387,051 (GRCm39) E101G probably damaging Het
Asxl2 T C 12: 3,546,593 (GRCm39) V459A possibly damaging Het
Cabs1 C T 5: 88,127,613 (GRCm39) T88I possibly damaging Het
Camta2 G A 11: 70,569,211 (GRCm39) A578V probably damaging Het
Cdc16 A G 8: 13,818,609 (GRCm39) N316D possibly damaging Het
Chrm3 T A 13: 9,928,476 (GRCm39) M187L possibly damaging Het
Clcn4 T C 7: 7,294,481 (GRCm39) T367A probably benign Het
Clcn7 T C 17: 25,376,928 (GRCm39) S654P probably damaging Het
Col6a3 T A 1: 90,701,387 (GRCm39) T2510S unknown Het
Crisp4 T C 1: 18,193,012 (GRCm39) E192G possibly damaging Het
Dmbt1 T A 7: 130,711,370 (GRCm39) probably null Het
Dnah5 T G 15: 28,204,177 (GRCm39) L18R probably benign Het
Dnah9 T G 11: 65,746,164 (GRCm39) D3983A probably benign Het
Dock5 C A 14: 68,097,361 (GRCm39) V71L probably benign Het
Dync1h1 T C 12: 110,584,427 (GRCm39) V610A probably damaging Het
Dynlrb2 A G 8: 117,242,428 (GRCm39) Y86C probably benign Het
Ep400 T C 5: 110,903,799 (GRCm39) I267V probably damaging Het
Gaa A G 11: 119,169,178 (GRCm39) Y575C probably damaging Het
Gm8094 T A 14: 42,934,020 (GRCm39) D24V probably benign Het
Grina T C 15: 76,133,087 (GRCm39) I244T possibly damaging Het
Haus6 A G 4: 86,501,993 (GRCm39) L626P possibly damaging Het
Hexd A T 11: 121,112,097 (GRCm39) H439L probably benign Het
Ifna12 A T 4: 88,521,531 (GRCm39) C5* probably null Het
Igf2bp2 G T 16: 21,894,843 (GRCm39) S300* probably null Het
Ighv6-5 T C 12: 114,380,362 (GRCm39) R71G probably benign Het
Lrrc37 A G 11: 103,504,969 (GRCm39) V2333A probably benign Het
Lrrn4cl T C 19: 8,829,252 (GRCm39) S77P probably damaging Het
Mast4 A G 13: 102,923,929 (GRCm39) L302P probably damaging Het
Mink1 T C 11: 70,500,927 (GRCm39) V831A possibly damaging Het
Mme T A 3: 63,207,674 (GRCm39) I40N probably damaging Het
Myh2 A G 11: 67,077,438 (GRCm39) T858A probably benign Het
Ncbp3 T A 11: 72,940,700 (GRCm39) Y67N probably damaging Het
Nedd1 T A 10: 92,534,104 (GRCm39) I349F possibly damaging Het
Nek11 A T 9: 105,200,368 (GRCm39) *81K probably null Het
Nrip1 A G 16: 76,090,718 (GRCm39) Y280H probably damaging Het
Obsl1 T C 1: 75,476,788 (GRCm39) D722G probably benign Het
Or10ag55-ps1 T G 2: 87,139,902 (GRCm39) S256R probably benign Het
Or2m12 A T 16: 19,105,181 (GRCm39) I104K probably damaging Het
Or4c29 A G 2: 88,740,734 (GRCm39) M1T probably null Het
Or5i1 A G 2: 87,613,100 (GRCm39) D72G possibly damaging Het
Or6c7 C T 10: 129,323,545 (GRCm39) T222I probably damaging Het
Pcdhb6 A G 18: 37,467,966 (GRCm39) I296V probably benign Het
Pcnx2 G T 8: 126,489,552 (GRCm39) L1681M probably damaging Het
Pdlim5 T C 3: 141,983,674 (GRCm39) R360G possibly damaging Het
Peli2 C T 14: 48,488,051 (GRCm39) Q81* probably null Het
Pitpnb C T 5: 111,486,263 (GRCm39) Q56* probably null Het
Ppp1r3a A G 6: 14,754,603 (GRCm39) S215P possibly damaging Het
Prrt3 A G 6: 113,471,989 (GRCm39) Y728H probably damaging Het
Rsf1 A AAGGCGACGG 7: 97,229,111 (GRCm39) probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Sbno1 T C 5: 124,516,542 (GRCm39) H1277R possibly damaging Het
Siglecg C A 7: 43,061,441 (GRCm39) N481K possibly damaging Het
Sirt6 C T 10: 81,462,339 (GRCm39) G20D probably damaging Het
Sit1 C A 4: 43,482,981 (GRCm39) R89S probably benign Het
Slc7a12 A G 3: 14,546,094 (GRCm39) R80G probably damaging Het
Smok3c T A 5: 138,062,747 (GRCm39) M78K probably benign Het
Stk10 T A 11: 32,553,654 (GRCm39) probably null Het
Tada2b A G 5: 36,634,008 (GRCm39) V190A probably damaging Het
Tnk1 C T 11: 69,747,780 (GRCm39) V41I probably damaging Het
Tpr T A 1: 150,299,567 (GRCm39) V1146E probably benign Het
Trappc9 T C 15: 72,929,930 (GRCm39) D142G probably benign Het
Trpm3 T C 19: 22,965,178 (GRCm39) Y1558H probably damaging Het
Unc5c C A 3: 141,383,914 (GRCm39) S97R probably damaging Het
Vmn1r172 T C 7: 23,359,583 (GRCm39) I156T probably damaging Het
Vps26a T G 10: 62,304,119 (GRCm39) E117D probably damaging Het
Zfp451 A T 1: 33,842,627 (GRCm39) probably benign Het
Zfp534 C A 4: 147,759,145 (GRCm39) R508I probably benign Het
Zp3r C T 1: 130,526,642 (GRCm39) C187Y probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGACTCTGTTTGGAAGGCC -3'
(R):5'- TCAGCATCAAAGGCAGCATTG -3'

Sequencing Primer
(F):5'- GCCAATGAAGAAAAAGGAGCAC -3'
(R):5'- GCAGCATTGCAAGGCTTC -3'
Posted On 2017-10-10