Incidental Mutation 'R0526:Fgd3'
ID48947
Institutional Source Beutler Lab
Gene Symbol Fgd3
Ensembl Gene ENSMUSG00000037946
Gene NameFYVE, RhoGEF and PH domain containing 3
SynonymsZFYVE5, 5830461L01Rik
MMRRC Submission 038719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0526 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49261554-49320311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49296524 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 83 (S83N)
Ref Sequence ENSEMBL: ENSMUSP00000105713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048716] [ENSMUST00000110086] [ENSMUST00000110087]
Predicted Effect probably benign
Transcript: ENSMUST00000048716
AA Change: S83N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048692
Gene: ENSMUSG00000037946
AA Change: S83N

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110086
AA Change: S83N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105713
Gene: ENSMUSG00000037946
AA Change: S83N

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110087
AA Change: S83N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105714
Gene: ENSMUSG00000037946
AA Change: S83N

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,455,224 N230I possibly damaging Het
4933427D14Rik G T 11: 72,169,783 Q687K probably damaging Het
Actrt2 A G 4: 154,667,412 L89P probably damaging Het
Adamts1 A C 16: 85,802,372 S113R probably benign Het
Agxt2 G T 15: 10,373,862 C118F probably damaging Het
Akap8 G A 17: 32,317,292 T49I probably benign Het
Alk A T 17: 71,869,753 W1519R probably damaging Het
Atf7ip T A 6: 136,559,805 F12Y probably damaging Het
Atp13a5 A G 16: 29,348,740 C131R probably damaging Het
Atp8b4 A G 2: 126,427,363 L168P probably damaging Het
Blm G T 7: 80,505,893 S346* probably null Het
Ccnt2 T G 1: 127,799,445 C199G probably damaging Het
Cd151 A T 7: 141,470,591 H219L probably damaging Het
Cd200r2 A T 16: 44,915,047 R248S probably damaging Het
Cdh3 A G 8: 106,555,446 D822G possibly damaging Het
Clec4b1 T C 6: 123,069,770 probably null Het
Cluh C A 11: 74,665,986 L951I probably benign Het
Cog7 A T 7: 121,963,271 probably null Het
Col25a1 C A 3: 130,476,394 P197Q probably damaging Het
Csde1 T A 3: 103,056,426 S636R possibly damaging Het
Ect2l C A 10: 18,199,940 C66F possibly damaging Het
Elac2 T C 11: 64,999,436 M671T probably benign Het
Evi5 T C 5: 107,821,748 N143S probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fbxo38 A G 18: 62,505,980 Y1084H probably damaging Het
Fcgr4 T A 1: 171,029,191 L209Q probably damaging Het
Gigyf2 T A 1: 87,421,493 M664K probably benign Het
Gm38394 T C 1: 133,658,734 I288M probably damaging Het
Il27ra A T 8: 84,039,499 S219T probably benign Het
Kif15 T C 9: 122,997,797 V800A probably damaging Het
Lmo7 T A 14: 101,900,560 D666E probably damaging Het
Lrp5 T C 19: 3,628,295 D520G probably damaging Het
Lrriq3 T A 3: 155,188,297 M545K probably benign Het
Lsm5 T A 6: 56,703,325 D44V probably damaging Het
Man1c1 G T 4: 134,569,068 Y430* probably null Het
Map4 T A 9: 110,037,278 probably null Het
Megf6 A G 4: 154,258,941 K561R probably benign Het
Myo1e T C 9: 70,322,398 Y173H probably damaging Het
Myo6 T A 9: 80,283,541 S791R possibly damaging Het
Nol11 C A 11: 107,184,771 E144* probably null Het
Ntng2 C T 2: 29,197,062 R416Q probably damaging Het
Nxpe3 T A 16: 55,866,517 I43F possibly damaging Het
Olfr1093 A T 2: 86,786,347 T206S possibly damaging Het
Olfr1284 T A 2: 111,379,492 V164E possibly damaging Het
Pkd1l2 T C 8: 117,082,260 I64V probably damaging Het
Prf1 G A 10: 61,300,254 R103H probably benign Het
Rest A G 5: 77,281,027 D431G probably damaging Het
Serpina10 A T 12: 103,616,868 L439Q probably damaging Het
Sgk3 T G 1: 9,881,579 V176G probably damaging Het
Slc19a3 A G 1: 83,022,733 S188P probably damaging Het
Sorbs1 A G 19: 40,349,948 I336T probably damaging Het
Ssfa2 A G 2: 79,657,346 D591G probably benign Het
Strip1 C T 3: 107,620,039 probably null Het
Syt4 T C 18: 31,443,746 E185G possibly damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tgfbr3l G T 8: 4,249,439 R74L possibly damaging Het
Thoc7 A G 14: 13,949,282 M194T probably benign Het
Thsd7b T C 1: 129,951,392 Y989H probably damaging Het
Tmem156 C T 5: 65,075,818 V134I probably benign Het
Tnks A T 8: 34,853,303 V738E probably benign Het
Trpm6 A T 19: 18,792,876 I342F probably damaging Het
Vmn2r69 A T 7: 85,411,503 V291D probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wnk1 T C 6: 119,951,992 T1292A probably damaging Het
Yes1 T A 5: 32,655,240 C285S probably benign Het
Zbtb49 T C 5: 38,213,919 N206S probably benign Het
Other mutations in Fgd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fgd3 APN 13 49275643 splice site probably benign
IGL00816:Fgd3 APN 13 49264786 splice site probably benign
IGL01797:Fgd3 APN 13 49289589 missense probably damaging 1.00
IGL01993:Fgd3 APN 13 49280188 missense possibly damaging 0.62
IGL02134:Fgd3 APN 13 49296749 missense possibly damaging 0.84
IGL02327:Fgd3 APN 13 49285798 missense probably damaging 1.00
IGL02367:Fgd3 APN 13 49287326 missense probably damaging 1.00
IGL02532:Fgd3 APN 13 49285761 missense probably damaging 1.00
IGL02830:Fgd3 APN 13 49264631 splice site probably benign
IGL02888:Fgd3 APN 13 49281816 critical splice donor site probably null
IGL03209:Fgd3 APN 13 49285818 missense probably damaging 1.00
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0285:Fgd3 UTSW 13 49263948 missense possibly damaging 0.89
R0617:Fgd3 UTSW 13 49264697 missense possibly damaging 0.80
R0648:Fgd3 UTSW 13 49296573 missense probably benign 0.23
R1529:Fgd3 UTSW 13 49266694 missense probably benign 0.19
R1577:Fgd3 UTSW 13 49281937 missense probably damaging 0.99
R1913:Fgd3 UTSW 13 49263848 missense possibly damaging 0.89
R2002:Fgd3 UTSW 13 49296455 missense probably benign 0.05
R4342:Fgd3 UTSW 13 49273709 critical splice donor site probably null
R4606:Fgd3 UTSW 13 49296560 missense probably damaging 1.00
R4810:Fgd3 UTSW 13 49289650 missense probably benign 0.01
R4885:Fgd3 UTSW 13 49263989 missense possibly damaging 0.66
R4962:Fgd3 UTSW 13 49266629 missense probably benign 0.03
R4974:Fgd3 UTSW 13 49278602 missense probably damaging 1.00
R5201:Fgd3 UTSW 13 49296378 missense probably benign 0.00
R5524:Fgd3 UTSW 13 49277577 missense probably damaging 0.97
R5588:Fgd3 UTSW 13 49287310 missense probably damaging 1.00
R5710:Fgd3 UTSW 13 49296729 missense probably benign 0.00
R5753:Fgd3 UTSW 13 49274940 missense possibly damaging 0.94
R6048:Fgd3 UTSW 13 49273748 missense probably benign 0.01
R6086:Fgd3 UTSW 13 49287296 missense probably benign 0.12
R7293:Fgd3 UTSW 13 49264658 missense probably benign 0.00
R7311:Fgd3 UTSW 13 49296690 missense possibly damaging 0.94
R7383:Fgd3 UTSW 13 49268309 missense possibly damaging 0.50
Z1176:Fgd3 UTSW 13 49281826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGAGTCAAGCTGACATCCTCC -3'
(R):5'- GCCTTCAACGACTGTACTGAGCTG -3'

Sequencing Primer
(F):5'- GCTGACATCCTCCTGAGGC -3'
(R):5'- AGAAGAAGCCATTTCCCCTCTTG -3'
Posted On2013-06-12