Mutagenetix > Incidental Mutation

Incidental Mutation 'R6154:Chrm3'

489473

Institutional Source

Beutler Lab

Gene Symbol

Chrm3

Ensembl Gene

ENSMUSG00000046159

Gene Name

cholinergic receptor, muscarinic 3, cardiac

Synonyms

muscarinic acetylcholine receptor 3, Chrm-3, M3R

MMRRC Submission

044301-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R6154 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9875486-10360847 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9878440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 187 (M187L)

Ref Sequence

ENSEMBL: ENSMUSP00000140131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]

AlphaFold

Q9ERZ3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063093
AA Change: M187L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: M187L

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	75	265	8.9e-7	PFAM
Pfam:7TM_GPCR_Srsx	78	270	6e-11	PFAM
Pfam:7tm_1	84	543	6.9e-82	PFAM
low complexity region	564	576	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187510
AA Change: M187L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: M187L

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	75	265	8.5e-7	PFAM
Pfam:7TM_GPCR_Srsx	78	270	6e-11	PFAM
Pfam:7tm_1	84	543	2.6e-88	PFAM
low complexity region	564	576	N/A	INTRINSIC

Meta Mutation Damage Score

0.1803

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.8%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss3	T	G	10: 107,123,349	I79L	probably benign	Het
Adam6a	C	T	12: 113,545,672	T555I	probably benign	Het
Adap1	A	G	5: 139,307,776	V60A	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Angpt1	T	C	15: 42,523,655	E101G	probably damaging	Het
Asxl2	T	C	12: 3,496,593	V459A	possibly damaging	Het
Cabs1	C	T	5: 87,979,754	T88I	possibly damaging	Het
Camta2	G	A	11: 70,678,385	A578V	probably damaging	Het
Cdc16	A	G	8: 13,768,609	N316D	possibly damaging	Het
Clcn4	T	C	7: 7,291,482	T367A	probably benign	Het
Clcn7	T	C	17: 25,157,954	S654P	probably damaging	Het
Col6a3	T	A	1: 90,773,665	T2510S	unknown	Het
Crisp4	T	C	1: 18,122,788	E192G	possibly damaging	Het
Dmbt1	T	A	7: 131,109,641		probably null	Het
Dnah5	T	G	15: 28,204,031	L18R	probably benign	Het
Dnah9	T	G	11: 65,855,338	D3983A	probably benign	Het
Dock5	C	A	14: 67,859,912	V71L	probably benign	Het
Dync1h1	T	C	12: 110,617,993	V610A	probably damaging	Het
Dynlrb2	A	G	8: 116,515,689	Y86C	probably benign	Het
Ep400	T	C	5: 110,755,933	I267V	probably damaging	Het
Gaa	A	G	11: 119,278,352	Y575C	probably damaging	Het
Gm8094	T	A	14: 43,076,563	D24V	probably benign	Het
Gm884	A	G	11: 103,614,143	V2333A	probably benign	Het
Grina	T	C	15: 76,248,887	I244T	possibly damaging	Het
Haus6	A	G	4: 86,583,756	L626P	possibly damaging	Het
Hexdc	A	T	11: 121,221,271	H439L	probably benign	Het
Ifna12	A	T	4: 88,603,294	C5*	probably null	Het
Igf2bp2	G	T	16: 22,076,093	S300*	probably null	Het
Ighv6-5	T	C	12: 114,416,742	R71G	probably benign	Het
Lrrn4cl	T	C	19: 8,851,888	S77P	probably damaging	Het
Mast4	A	G	13: 102,787,421	L302P	probably damaging	Het
Mink1	T	C	11: 70,610,101	V831A	possibly damaging	Het
Mme	T	A	3: 63,300,253	I40N	probably damaging	Het
Myh2	A	G	11: 67,186,612	T858A	probably benign	Het
Ncbp3	T	A	11: 73,049,874	Y67N	probably damaging	Het
Nedd1	T	A	10: 92,698,242	I349F	possibly damaging	Het
Nek11	A	T	9: 105,323,169	*81K	probably null	Het
Nrip1	A	G	16: 76,293,830	Y280H	probably damaging	Het
Obsl1	T	C	1: 75,500,144	D722G	probably benign	Het
Olfr1117-ps1	T	G	2: 87,309,558	S256R	probably benign	Het
Olfr1209	A	G	2: 88,910,390	M1T	probably null	Het
Olfr152	A	G	2: 87,782,756	D72G	possibly damaging	Het
Olfr164	A	T	16: 19,286,431	I104K	probably damaging	Het
Olfr789	C	T	10: 129,487,676	T222I	probably damaging	Het
Pcdhb6	A	G	18: 37,334,913	I296V	probably benign	Het
Pcnx2	G	T	8: 125,762,813	L1681M	probably damaging	Het
Pdlim5	T	C	3: 142,277,913	R360G	possibly damaging	Het
Peli2	C	T	14: 48,250,594	Q81*	probably null	Het
Pitpnb	C	T	5: 111,338,397	Q56*	probably null	Het
Ppp1r3a	A	G	6: 14,754,604	S215P	possibly damaging	Het
Prrt3	A	G	6: 113,495,028	Y728H	probably damaging	Het
Rsf1	A	AAGGCGACGG	7: 97,579,904		probably null	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Sbno1	T	C	5: 124,378,479	H1277R	possibly damaging	Het
Siglecg	C	A	7: 43,412,017	N481K	possibly damaging	Het
Sirt6	C	T	10: 81,626,505	G20D	probably damaging	Het
Sit1	C	A	4: 43,482,981	R89S	probably benign	Het
Slc7a12	A	G	3: 14,481,034	R80G	probably damaging	Het
Smok3c	T	A	5: 138,064,485	M78K	probably benign	Het
Stk10	T	A	11: 32,603,654		probably null	Het
Tada2b	A	G	5: 36,476,664	V190A	probably damaging	Het
Tnk1	C	T	11: 69,856,954	V41I	probably damaging	Het
Tpr	T	A	1: 150,423,816	V1146E	probably benign	Het
Trappc9	T	C	15: 73,058,081	D142G	probably benign	Het
Trpm3	T	C	19: 22,987,814	Y1558H	probably damaging	Het
Unc5c	C	A	3: 141,678,153	S97R	probably damaging	Het
Vmn1r172	T	C	7: 23,660,158	I156T	probably damaging	Het
Vmn2r51	A	T	7: 10,087,994	M588K	possibly damaging	Het
Vps26a	T	G	10: 62,468,340	E117D	probably damaging	Het
Zfp451	A	T	1: 33,803,546		probably benign	Het
Zfp534	C	A	4: 147,674,688	R508I	probably benign	Het
Zp3r	C	T	1: 130,598,905	C187Y	probably damaging	Het

Other mutations in Chrm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01608:Chrm3	APN	13	9878598	missense	possibly damaging	0.80
IGL02266:Chrm3	APN	13	9877278	missense	probably damaging	0.99
IGL02701:Chrm3	APN	13	9878464	nonsense	probably null
IGL03085:Chrm3	APN	13	9877534	missense	probably damaging	1.00
IGL03213:Chrm3	APN	13	9878184	missense	probably benign	0.22
R0147:Chrm3	UTSW	13	9878744	missense	probably damaging	1.00
R0408:Chrm3	UTSW	13	9877933	missense	probably benign	0.10
R0544:Chrm3	UTSW	13	9877579	missense	probably damaging	0.99
R1557:Chrm3	UTSW	13	9878314	missense	possibly damaging	0.82
R1647:Chrm3	UTSW	13	9878425	missense	probably damaging	1.00
R1697:Chrm3	UTSW	13	9878758	missense	probably damaging	1.00
R1791:Chrm3	UTSW	13	9877416	missense	probably damaging	1.00
R1866:Chrm3	UTSW	13	9878481	missense	probably damaging	1.00
R2049:Chrm3	UTSW	13	9878335	missense	probably damaging	1.00
R2909:Chrm3	UTSW	13	9877997	missense	probably benign	0.43
R4212:Chrm3	UTSW	13	9877755	missense	probably benign	0.01
R4422:Chrm3	UTSW	13	9878555	nonsense	probably null
R4790:Chrm3	UTSW	13	9877662	missense	probably benign	0.10
R4934:Chrm3	UTSW	13	9877414	missense	probably damaging	1.00
R5353:Chrm3	UTSW	13	9878557	missense	probably damaging	1.00
R5623:Chrm3	UTSW	13	9877387	missense	possibly damaging	0.92
R6416:Chrm3	UTSW	13	9877662	missense	probably benign
R6693:Chrm3	UTSW	13	9877422	missense	probably benign	0.27
R7135:Chrm3	UTSW	13	9877801	missense	probably benign	0.00
R7297:Chrm3	UTSW	13	9877833	missense	probably benign	0.01
R7423:Chrm3	UTSW	13	9878809	missense	probably benign
R7591:Chrm3	UTSW	13	9877313	nonsense	probably null
R8353:Chrm3	UTSW	13	9877231	makesense	probably null
R8355:Chrm3	UTSW	13	9878610	missense	probably damaging	1.00
R8446:Chrm3	UTSW	13	9878302	missense	probably damaging	0.99
R8453:Chrm3	UTSW	13	9877231	makesense	probably null
R9227:Chrm3	UTSW	13	9878443	missense	probably benign	0.00
R9230:Chrm3	UTSW	13	9878443	missense	probably benign	0.00
R9336:Chrm3	UTSW	13	9878616	missense	probably damaging	1.00
R9462:Chrm3	UTSW	13	9877401	missense
R9537:Chrm3	UTSW	13	9877426	missense	probably damaging	1.00
R9586:Chrm3	UTSW	13	9877444	missense	probably damaging	1.00
X0066:Chrm3	UTSW	13	9877720	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGCCAGCTCTTTGGTACGTTTC -3'
(R):5'- TCATTATGAACCGCTGGGCTC -3'

Sequencing Primer
(F):5'- GGTACGTTTCTCAGTCTCCTTATAG -3'
(R):5'- CTCTGGGGAACTTAGCCTGTGAC -3'

Posted On

2017-10-10