Incidental Mutation 'R6154:Chrm3'
ID 489473
Institutional Source Beutler Lab
Gene Symbol Chrm3
Ensembl Gene ENSMUSG00000046159
Gene Name cholinergic receptor, muscarinic 3, cardiac
Synonyms muscarinic acetylcholine receptor 3, Chrm-3, M3R
MMRRC Submission 044301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R6154 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 9875486-10360847 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9878440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 187 (M187L)
Ref Sequence ENSEMBL: ENSMUSP00000140131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]
AlphaFold Q9ERZ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000063093
AA Change: M187L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: M187L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 6.9e-82 PFAM
low complexity region 564 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187510
AA Change: M187L

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: M187L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 2.6e-88 PFAM
low complexity region 564 576 N/A INTRINSIC
Meta Mutation Damage Score 0.1803 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T G 10: 107,123,349 I79L probably benign Het
Adam6a C T 12: 113,545,672 T555I probably benign Het
Adap1 A G 5: 139,307,776 V60A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Angpt1 T C 15: 42,523,655 E101G probably damaging Het
Asxl2 T C 12: 3,496,593 V459A possibly damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Camta2 G A 11: 70,678,385 A578V probably damaging Het
Cdc16 A G 8: 13,768,609 N316D possibly damaging Het
Clcn4 T C 7: 7,291,482 T367A probably benign Het
Clcn7 T C 17: 25,157,954 S654P probably damaging Het
Col6a3 T A 1: 90,773,665 T2510S unknown Het
Crisp4 T C 1: 18,122,788 E192G possibly damaging Het
Dmbt1 T A 7: 131,109,641 probably null Het
Dnah5 T G 15: 28,204,031 L18R probably benign Het
Dnah9 T G 11: 65,855,338 D3983A probably benign Het
Dock5 C A 14: 67,859,912 V71L probably benign Het
Dync1h1 T C 12: 110,617,993 V610A probably damaging Het
Dynlrb2 A G 8: 116,515,689 Y86C probably benign Het
Ep400 T C 5: 110,755,933 I267V probably damaging Het
Gaa A G 11: 119,278,352 Y575C probably damaging Het
Gm8094 T A 14: 43,076,563 D24V probably benign Het
Gm884 A G 11: 103,614,143 V2333A probably benign Het
Grina T C 15: 76,248,887 I244T possibly damaging Het
Haus6 A G 4: 86,583,756 L626P possibly damaging Het
Hexdc A T 11: 121,221,271 H439L probably benign Het
Ifna12 A T 4: 88,603,294 C5* probably null Het
Igf2bp2 G T 16: 22,076,093 S300* probably null Het
Ighv6-5 T C 12: 114,416,742 R71G probably benign Het
Lrrn4cl T C 19: 8,851,888 S77P probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mink1 T C 11: 70,610,101 V831A possibly damaging Het
Mme T A 3: 63,300,253 I40N probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Ncbp3 T A 11: 73,049,874 Y67N probably damaging Het
Nedd1 T A 10: 92,698,242 I349F possibly damaging Het
Nek11 A T 9: 105,323,169 *81K probably null Het
Nrip1 A G 16: 76,293,830 Y280H probably damaging Het
Obsl1 T C 1: 75,500,144 D722G probably benign Het
Olfr1117-ps1 T G 2: 87,309,558 S256R probably benign Het
Olfr1209 A G 2: 88,910,390 M1T probably null Het
Olfr152 A G 2: 87,782,756 D72G possibly damaging Het
Olfr164 A T 16: 19,286,431 I104K probably damaging Het
Olfr789 C T 10: 129,487,676 T222I probably damaging Het
Pcdhb6 A G 18: 37,334,913 I296V probably benign Het
Pcnx2 G T 8: 125,762,813 L1681M probably damaging Het
Pdlim5 T C 3: 142,277,913 R360G possibly damaging Het
Peli2 C T 14: 48,250,594 Q81* probably null Het
Pitpnb C T 5: 111,338,397 Q56* probably null Het
Ppp1r3a A G 6: 14,754,604 S215P possibly damaging Het
Prrt3 A G 6: 113,495,028 Y728H probably damaging Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sbno1 T C 5: 124,378,479 H1277R possibly damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Sirt6 C T 10: 81,626,505 G20D probably damaging Het
Sit1 C A 4: 43,482,981 R89S probably benign Het
Slc7a12 A G 3: 14,481,034 R80G probably damaging Het
Smok3c T A 5: 138,064,485 M78K probably benign Het
Stk10 T A 11: 32,603,654 probably null Het
Tada2b A G 5: 36,476,664 V190A probably damaging Het
Tnk1 C T 11: 69,856,954 V41I probably damaging Het
Tpr T A 1: 150,423,816 V1146E probably benign Het
Trappc9 T C 15: 73,058,081 D142G probably benign Het
Trpm3 T C 19: 22,987,814 Y1558H probably damaging Het
Unc5c C A 3: 141,678,153 S97R probably damaging Het
Vmn1r172 T C 7: 23,660,158 I156T probably damaging Het
Vmn2r51 A T 7: 10,087,994 M588K possibly damaging Het
Vps26a T G 10: 62,468,340 E117D probably damaging Het
Zfp451 A T 1: 33,803,546 probably benign Het
Zfp534 C A 4: 147,674,688 R508I probably benign Het
Zp3r C T 1: 130,598,905 C187Y probably damaging Het
Other mutations in Chrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Chrm3 APN 13 9878598 missense possibly damaging 0.80
IGL02266:Chrm3 APN 13 9877278 missense probably damaging 0.99
IGL02701:Chrm3 APN 13 9878464 nonsense probably null
IGL03085:Chrm3 APN 13 9877534 missense probably damaging 1.00
IGL03213:Chrm3 APN 13 9878184 missense probably benign 0.22
R0147:Chrm3 UTSW 13 9878744 missense probably damaging 1.00
R0408:Chrm3 UTSW 13 9877933 missense probably benign 0.10
R0544:Chrm3 UTSW 13 9877579 missense probably damaging 0.99
R1557:Chrm3 UTSW 13 9878314 missense possibly damaging 0.82
R1647:Chrm3 UTSW 13 9878425 missense probably damaging 1.00
R1697:Chrm3 UTSW 13 9878758 missense probably damaging 1.00
R1791:Chrm3 UTSW 13 9877416 missense probably damaging 1.00
R1866:Chrm3 UTSW 13 9878481 missense probably damaging 1.00
R2049:Chrm3 UTSW 13 9878335 missense probably damaging 1.00
R2909:Chrm3 UTSW 13 9877997 missense probably benign 0.43
R4212:Chrm3 UTSW 13 9877755 missense probably benign 0.01
R4422:Chrm3 UTSW 13 9878555 nonsense probably null
R4790:Chrm3 UTSW 13 9877662 missense probably benign 0.10
R4934:Chrm3 UTSW 13 9877414 missense probably damaging 1.00
R5353:Chrm3 UTSW 13 9878557 missense probably damaging 1.00
R5623:Chrm3 UTSW 13 9877387 missense possibly damaging 0.92
R6416:Chrm3 UTSW 13 9877662 missense probably benign
R6693:Chrm3 UTSW 13 9877422 missense probably benign 0.27
R7135:Chrm3 UTSW 13 9877801 missense probably benign 0.00
R7297:Chrm3 UTSW 13 9877833 missense probably benign 0.01
R7423:Chrm3 UTSW 13 9878809 missense probably benign
R7591:Chrm3 UTSW 13 9877313 nonsense probably null
R8353:Chrm3 UTSW 13 9877231 makesense probably null
R8355:Chrm3 UTSW 13 9878610 missense probably damaging 1.00
R8446:Chrm3 UTSW 13 9878302 missense probably damaging 0.99
R8453:Chrm3 UTSW 13 9877231 makesense probably null
R9227:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9230:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9336:Chrm3 UTSW 13 9878616 missense probably damaging 1.00
R9462:Chrm3 UTSW 13 9877401 missense
R9537:Chrm3 UTSW 13 9877426 missense probably damaging 1.00
R9586:Chrm3 UTSW 13 9877444 missense probably damaging 1.00
X0066:Chrm3 UTSW 13 9877720 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCCAGCTCTTTGGTACGTTTC -3'
(R):5'- TCATTATGAACCGCTGGGCTC -3'

Sequencing Primer
(F):5'- GGTACGTTTCTCAGTCTCCTTATAG -3'
(R):5'- CTCTGGGGAACTTAGCCTGTGAC -3'
Posted On 2017-10-10