Incidental Mutation 'R6154:Afg3l2'
ID 489487
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
MMRRC Submission 044301-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6154 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 67421259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T G 10: 107,123,349 I79L probably benign Het
Adam6a C T 12: 113,545,672 T555I probably benign Het
Adap1 A G 5: 139,307,776 V60A possibly damaging Het
Angpt1 T C 15: 42,523,655 E101G probably damaging Het
Asxl2 T C 12: 3,496,593 V459A possibly damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Camta2 G A 11: 70,678,385 A578V probably damaging Het
Cdc16 A G 8: 13,768,609 N316D possibly damaging Het
Chrm3 T A 13: 9,878,440 M187L possibly damaging Het
Clcn4 T C 7: 7,291,482 T367A probably benign Het
Clcn7 T C 17: 25,157,954 S654P probably damaging Het
Col6a3 T A 1: 90,773,665 T2510S unknown Het
Crisp4 T C 1: 18,122,788 E192G possibly damaging Het
Dmbt1 T A 7: 131,109,641 probably null Het
Dnah5 T G 15: 28,204,031 L18R probably benign Het
Dnah9 T G 11: 65,855,338 D3983A probably benign Het
Dock5 C A 14: 67,859,912 V71L probably benign Het
Dync1h1 T C 12: 110,617,993 V610A probably damaging Het
Dynlrb2 A G 8: 116,515,689 Y86C probably benign Het
Ep400 T C 5: 110,755,933 I267V probably damaging Het
Gaa A G 11: 119,278,352 Y575C probably damaging Het
Gm8094 T A 14: 43,076,563 D24V probably benign Het
Gm884 A G 11: 103,614,143 V2333A probably benign Het
Grina T C 15: 76,248,887 I244T possibly damaging Het
Haus6 A G 4: 86,583,756 L626P possibly damaging Het
Hexdc A T 11: 121,221,271 H439L probably benign Het
Ifna12 A T 4: 88,603,294 C5* probably null Het
Igf2bp2 G T 16: 22,076,093 S300* probably null Het
Ighv6-5 T C 12: 114,416,742 R71G probably benign Het
Lrrn4cl T C 19: 8,851,888 S77P probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mink1 T C 11: 70,610,101 V831A possibly damaging Het
Mme T A 3: 63,300,253 I40N probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Ncbp3 T A 11: 73,049,874 Y67N probably damaging Het
Nedd1 T A 10: 92,698,242 I349F possibly damaging Het
Nek11 A T 9: 105,323,169 *81K probably null Het
Nrip1 A G 16: 76,293,830 Y280H probably damaging Het
Obsl1 T C 1: 75,500,144 D722G probably benign Het
Olfr1117-ps1 T G 2: 87,309,558 S256R probably benign Het
Olfr1209 A G 2: 88,910,390 M1T probably null Het
Olfr152 A G 2: 87,782,756 D72G possibly damaging Het
Olfr164 A T 16: 19,286,431 I104K probably damaging Het
Olfr789 C T 10: 129,487,676 T222I probably damaging Het
Pcdhb6 A G 18: 37,334,913 I296V probably benign Het
Pcnx2 G T 8: 125,762,813 L1681M probably damaging Het
Pdlim5 T C 3: 142,277,913 R360G possibly damaging Het
Peli2 C T 14: 48,250,594 Q81* probably null Het
Pitpnb C T 5: 111,338,397 Q56* probably null Het
Ppp1r3a A G 6: 14,754,604 S215P possibly damaging Het
Prrt3 A G 6: 113,495,028 Y728H probably damaging Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sbno1 T C 5: 124,378,479 H1277R possibly damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Sirt6 C T 10: 81,626,505 G20D probably damaging Het
Sit1 C A 4: 43,482,981 R89S probably benign Het
Slc7a12 A G 3: 14,481,034 R80G probably damaging Het
Smok3c T A 5: 138,064,485 M78K probably benign Het
Stk10 T A 11: 32,603,654 probably null Het
Tada2b A G 5: 36,476,664 V190A probably damaging Het
Tnk1 C T 11: 69,856,954 V41I probably damaging Het
Tpr T A 1: 150,423,816 V1146E probably benign Het
Trappc9 T C 15: 73,058,081 D142G probably benign Het
Trpm3 T C 19: 22,987,814 Y1558H probably damaging Het
Unc5c C A 3: 141,678,153 S97R probably damaging Het
Vmn1r172 T C 7: 23,660,158 I156T probably damaging Het
Vmn2r51 A T 7: 10,087,994 M588K possibly damaging Het
Vps26a T G 10: 62,468,340 E117D probably damaging Het
Zfp451 A T 1: 33,803,546 probably benign Het
Zfp534 C A 4: 147,674,688 R508I probably benign Het
Zp3r C T 1: 130,598,905 C187Y probably damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67429196 missense probably benign
R9222:Afg3l2 UTSW 18 67434187 missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67434192 missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67442381 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'
Posted On 2017-10-10