Mutagenetix > Incidental Mutation

Incidental Mutation 'R6155:Npas2'

489491

Institutional Source

Beutler Lab

Gene Symbol

Npas2

Ensembl Gene

ENSMUSG00000026077

Gene Name

neuronal PAS domain protein 2

Synonyms

bHLHe9, MOP4

MMRRC Submission

044302-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

39193731-39363236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 39287476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 14 (R14Q)

Ref Sequence

ENSEMBL: ENSMUSP00000054719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056815] [ENSMUST00000173050]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000056815
AA Change: R14Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: R14Q

Domain	Start	End	E-Value	Type
HLH	15	65	6.56e-10	SMART
PAS	84	150	4.28e-10	SMART
PAS	239	305	4.03e-6	SMART
PAC	311	354	6.2e-7	SMART
low complexity region	400	419	N/A	INTRINSIC
coiled coil region	510	538	N/A	INTRINSIC
low complexity region	563	583	N/A	INTRINSIC
low complexity region	623	643	N/A	INTRINSIC
low complexity region	745	768	N/A	INTRINSIC
low complexity region	798	816	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000173050
AA Change: R14Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134241
Gene: ENSMUSG00000026077
AA Change: R14Q

Domain	Start	End	E-Value	Type
HLH	15	60	1.08e-5	SMART

Meta Mutation Damage Score

0.4442

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 104,963,644	Y319C	probably benign	Het
Actn4	A	C	7: 28,896,141	I763S	probably damaging	Het
Actr8	G	A	14: 29,978,589		probably null	Het
Adrb1	T	C	19: 56,722,904	L178P	probably damaging	Het
Afap1	A	G	5: 35,935,609	Y19C	unknown	Het
Ankrd36	A	G	11: 5,687,442	E1337G	probably benign	Het
Arl4a	A	C	12: 40,036,520	V76G	probably damaging	Het
B230118H07Rik	A	T	2: 101,576,010		probably null	Het
Bmp1	A	T	14: 70,508,007	I246K	probably damaging	Het
Camk4	A	T	18: 32,939,447	T18S	unknown	Het
Cep152	T	C	2: 125,581,700	H927R	probably benign	Het
Clca3a2	A	G	3: 144,819,357	I38T	probably damaging	Het
Clec2g	A	C	6: 128,980,273	T54P	probably damaging	Het
Cox20	A	G	1: 178,321,797	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,753,017	H407Q	probably benign	Het
Csmd1	T	C	8: 15,903,231	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,910,359	H700Q	probably null	Het
Dnah10	G	A	5: 124,770,599	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,785,175	T2165A	probably damaging	Het
Dock2	C	G	11: 34,294,123	M1072I	probably benign	Het
F11	T	A	8: 45,252,082	T141S	probably damaging	Het
Gabra6	T	A	11: 42,316,523	I245F	probably damaging	Het
Gm13101	T	A	4: 143,965,142	H337L	probably benign	Het
Gm8909	G	A	17: 36,167,507	A211V	possibly damaging	Het
Herc1	T	A	9: 66,433,423	C1685S	possibly damaging	Het
Il20	G	T	1: 130,910,740	D73E	probably damaging	Het
Ireb2	C	A	9: 54,886,527	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,588,378	I220V	probably benign	Het
Lce1j	T	G	3: 92,789,072	Q133P	unknown	Het
Lgals9	C	T	11: 78,963,505	A287T	probably benign	Het
Lrrc52	A	G	1: 167,466,727		probably benign	Het
Map3k5	A	T	10: 20,118,441	H1027L	probably benign	Het
Morc3	A	G	16: 93,862,425	D407G	possibly damaging	Het
Myom1	T	C	17: 71,108,695		probably null	Het
Ncapg2	T	C	12: 116,438,011	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,407,448	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,431,051	F298I	probably damaging	Het
Npas4	C	T	19: 4,986,870	C422Y	probably damaging	Het
Olfr1230	A	G	2: 89,296,421	L283S	probably damaging	Het
Olfr1381	T	A	11: 49,552,584	I279N	possibly damaging	Het
Olfr481	T	C	7: 108,081,286	V164A	probably benign	Het
Olfr749	T	C	14: 50,736,619	D181G	probably benign	Het
Pcdhga4	T	C	18: 37,686,493	I365T	probably damaging	Het
Pear1	T	A	3: 87,759,568	T37S	probably damaging	Het
Pkn2	A	T	3: 142,853,693	F24I	probably benign	Het
Plcb3	G	A	19: 6,966,165	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,730,133		probably null	Het
Psmb3	T	A	11: 97,712,452	F164I	probably damaging	Het
Ptch2	T	A	4: 117,096,908	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Pusl1	A	G	4: 155,890,548	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,402,501	L35I	probably damaging	Het
Rictor	T	C	15: 6,793,977	L1545P	probably benign	Het
Rtn4r	A	T	16: 18,151,394	M229L	probably benign	Het
Ruvbl1	A	T	6: 88,479,125		probably null	Het
Slc35b3	A	T	13: 38,944,596	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,398,697	V207A	possibly damaging	Het
Sox13	A	G	1: 133,393,267	S2P	probably damaging	Het
Sptbn1	A	C	11: 30,137,403	L999R	probably damaging	Het
Taf4	A	G	2: 179,913,524	V1015A	probably damaging	Het
Top3b	T	C	16: 16,891,509	L687P	probably damaging	Het
Tpp2	T	A	1: 43,956,489	V268E	probably damaging	Het
Ttc6	T	C	12: 57,737,616	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,700,726	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,428,690	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,065,881	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,022,038		probably null	Het
Zzz3	A	G	3: 152,427,682	I126V	possibly damaging	Het

Other mutations in Npas2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02560:Npas2	APN	1	39333961	splice site	probably benign
IGL02608:Npas2	APN	1	39345446	missense	probably benign	0.06
IGL02882:Npas2	APN	1	39312996	missense	probably benign	0.08
IGL02976:Npas2	APN	1	39287484	missense	probably damaging	1.00
IGL03130:Npas2	APN	1	39313028	missense	probably damaging	1.00
IGL03297:Npas2	APN	1	39292690	missense	possibly damaging	0.71
R1263:Npas2	UTSW	1	39334768	missense	possibly damaging	0.51
R1514:Npas2	UTSW	1	39311854	missense	possibly damaging	0.82
R1618:Npas2	UTSW	1	39300727	missense	probably damaging	1.00
R1620:Npas2	UTSW	1	39333912	missense	possibly damaging	0.68
R1844:Npas2	UTSW	1	39325375	missense	probably damaging	1.00
R1868:Npas2	UTSW	1	39300678	missense	probably benign	0.03
R1892:Npas2	UTSW	1	39345422	missense	probably benign	0.00
R2002:Npas2	UTSW	1	39338195	missense	probably benign	0.10
R3157:Npas2	UTSW	1	39347609	missense	possibly damaging	0.92
R3551:Npas2	UTSW	1	39287562	missense	probably benign	0.05
R4564:Npas2	UTSW	1	39287566	missense	probably damaging	1.00
R4907:Npas2	UTSW	1	39361985	missense	unknown
R5044:Npas2	UTSW	1	39347506	nonsense	probably null
R5621:Npas2	UTSW	1	39359713	missense	probably benign
R5779:Npas2	UTSW	1	39287571	missense	possibly damaging	0.48
R5822:Npas2	UTSW	1	39347566	missense	probably benign	0.00
R6033:Npas2	UTSW	1	39338180	missense	probably damaging	0.99
R6033:Npas2	UTSW	1	39338180	missense	probably damaging	0.99
R6193:Npas2	UTSW	1	39292762	missense	probably damaging	1.00
R6220:Npas2	UTSW	1	39336061	missense	probably benign	0.00
R6341:Npas2	UTSW	1	39300687	missense	probably damaging	0.98
R6656:Npas2	UTSW	1	39361948	missense	unknown
R6778:Npas2	UTSW	1	39325300	missense	possibly damaging	0.92
R6803:Npas2	UTSW	1	39336049	missense	probably benign	0.35
R7165:Npas2	UTSW	1	39292717	missense	possibly damaging	0.79
R7250:Npas2	UTSW	1	39338107	missense	probably damaging	1.00
R7268:Npas2	UTSW	1	39287577	missense	probably damaging	0.98
R7284:Npas2	UTSW	1	39324467	missense	probably benign	0.36
R7833:Npas2	UTSW	1	39326147	missense	probably damaging	1.00
R7994:Npas2	UTSW	1	39328337	missense	possibly damaging	0.86
R8013:Npas2	UTSW	1	39338065	missense	probably benign
R8054:Npas2	UTSW	1	39287571	missense	possibly damaging	0.69
R8510:Npas2	UTSW	1	39287472	missense	probably damaging	1.00
R8683:Npas2	UTSW	1	39347627	missense	probably benign	0.00
R8738:Npas2	UTSW	1	39292716	missense	possibly damaging	0.65
R8779:Npas2	UTSW	1	39338186	missense	probably damaging	0.99
R9283:Npas2	UTSW	1	39287608	missense	probably damaging	1.00
R9541:Npas2	UTSW	1	39338113	missense	possibly damaging	0.94
R9675:Npas2	UTSW	1	39325365	missense	probably damaging	1.00
Z1176:Npas2	UTSW	1	39336010	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TAGCAAAACATGTTTCTTGCCCC -3'
(R):5'- ACTCATCACCTGCAGGAAGG -3'

Sequencing Primer
(F):5'- CCATTACTCAGCTCCAAAATGTG -3'
(R):5'- CATCACCTGCAGGAAGGGTAGG -3'

Posted On

2017-10-10