Mutagenetix > Incidental Mutations

Incidental Mutation 'R6155:Tpp2'

489492

Institutional Source

Beutler Lab

Gene Symbol

Tpp2

Ensembl Gene

ENSMUSG00000041763

Gene Name

tripeptidyl peptidase II

Synonyms

TppII

MMRRC Submission

044302-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.556) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43933647-44003000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43956489 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 268 (V268E)

Ref Sequence

ENSEMBL: ENSMUSP00000140562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087933
AA Change: V268E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: V268E

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	35	500	1.4e-96	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	777	964	2.4e-80	PFAM
low complexity region	1017	1033	N/A	INTRINSIC
PDB:3LXU\|X	1034	1262	1e-20	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186028

Predicted Effect

probably damaging
Transcript: ENSMUST00000188302
AA Change: V268E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763
AA Change: V268E

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	4.3e-84	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188313
AA Change: V268E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: V268E

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	5.1e-83	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	966	2.7e-93	PFAM
low complexity region	1004	1020	N/A	INTRINSIC
PDB:3LXU\|X	1021	1249	1e-20	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000189388
AA Change: V268E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: V268E

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	2.3e-81	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	880	7.8e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190401

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 104,963,644	Y319C	probably benign	Het
Actn4	A	C	7: 28,896,141	I763S	probably damaging	Het
Actr8	G	A	14: 29,978,589		probably null	Het
Adrb1	T	C	19: 56,722,904	L178P	probably damaging	Het
Afap1	A	G	5: 35,935,609	Y19C	unknown	Het
Ankrd36	A	G	11: 5,687,442	E1337G	probably benign	Het
Arl4a	A	C	12: 40,036,520	V76G	probably damaging	Het
B230118H07Rik	A	T	2: 101,576,010		probably null	Het
Bmp1	A	T	14: 70,508,007	I246K	probably damaging	Het
Camk4	A	T	18: 32,939,447	T18S	unknown	Het
Cep152	T	C	2: 125,581,700	H927R	probably benign	Het
Clca3a2	A	G	3: 144,819,357	I38T	probably damaging	Het
Clec2g	A	C	6: 128,980,273	T54P	probably damaging	Het
Cox20	A	G	1: 178,321,797	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,753,017	H407Q	probably benign	Het
Csmd1	T	C	8: 15,903,231	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,910,359	H700Q	probably null	Het
Dnah10	G	A	5: 124,770,599	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,785,175	T2165A	probably damaging	Het
Dock2	C	G	11: 34,294,123	M1072I	probably benign	Het
F11	T	A	8: 45,252,082	T141S	probably damaging	Het
Gabra6	T	A	11: 42,316,523	I245F	probably damaging	Het
Gm13101	T	A	4: 143,965,142	H337L	probably benign	Het
Gm8909	G	A	17: 36,167,507	A211V	possibly damaging	Het
Herc1	T	A	9: 66,433,423	C1685S	possibly damaging	Het
Il20	G	T	1: 130,910,740	D73E	probably damaging	Het
Ireb2	C	A	9: 54,886,527	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,588,378	I220V	probably benign	Het
Lce1j	T	G	3: 92,789,072	Q133P	unknown	Het
Lgals9	C	T	11: 78,963,505	A287T	probably benign	Het
Lrrc52	A	G	1: 167,466,727		probably benign	Het
Map3k5	A	T	10: 20,118,441	H1027L	probably benign	Het
Morc3	A	G	16: 93,862,425	D407G	possibly damaging	Het
Myom1	T	C	17: 71,108,695		probably null	Het
Ncapg2	T	C	12: 116,438,011	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,407,448	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,431,051	F298I	probably damaging	Het
Npas2	G	A	1: 39,287,476	R14Q	probably damaging	Het
Npas4	C	T	19: 4,986,870	C422Y	probably damaging	Het
Olfr1230	A	G	2: 89,296,421	L283S	probably damaging	Het
Olfr1381	T	A	11: 49,552,584	I279N	possibly damaging	Het
Olfr481	T	C	7: 108,081,286	V164A	probably benign	Het
Olfr749	T	C	14: 50,736,619	D181G	probably benign	Het
Pcdhga4	T	C	18: 37,686,493	I365T	probably damaging	Het
Pear1	T	A	3: 87,759,568	T37S	probably damaging	Het
Pkn2	A	T	3: 142,853,693	F24I	probably benign	Het
Plcb3	G	A	19: 6,966,165	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,730,133		probably null	Het
Psmb3	T	A	11: 97,712,452	F164I	probably damaging	Het
Ptch2	T	A	4: 117,096,908	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Pusl1	A	G	4: 155,890,548	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,402,501	L35I	probably damaging	Het
Rictor	T	C	15: 6,793,977	L1545P	probably benign	Het
Rtn4r	A	T	16: 18,151,394	M229L	probably benign	Het
Ruvbl1	A	T	6: 88,479,125		probably null	Het
Slc35b3	A	T	13: 38,944,596	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,398,697	V207A	possibly damaging	Het
Sox13	A	G	1: 133,393,267	S2P	probably damaging	Het
Sptbn1	A	C	11: 30,137,403	L999R	probably damaging	Het
Taf4	A	G	2: 179,913,524	V1015A	probably damaging	Het
Top3b	T	C	16: 16,891,509	L687P	probably damaging	Het
Ttc6	T	C	12: 57,737,616	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,700,726	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,428,690	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,065,881	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,022,038		probably null	Het
Zzz3	A	G	3: 152,427,682	I126V	possibly damaging	Het

Other mutations in Tpp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Tpp2	APN	1	43983291	missense	possibly damaging	0.90
IGL01021:Tpp2	APN	1	43934187	nonsense	probably null
IGL01096:Tpp2	APN	1	43960888	missense	probably damaging	1.00
IGL01344:Tpp2	APN	1	43983262	missense	probably benign	0.04
IGL01642:Tpp2	APN	1	43954653	missense	probably damaging	1.00
IGL02719:Tpp2	APN	1	43940231	missense	probably benign	0.09
IGL02890:Tpp2	APN	1	43999690	missense	probably damaging	1.00
IGL03102:Tpp2	APN	1	43956489	missense	probably damaging	1.00
IGL03175:Tpp2	APN	1	43973511	missense	probably benign	0.35
beaver	UTSW	1	43971715	missense	probably benign	0.08
billingsly	UTSW	1	43983552	missense	probably damaging	1.00
cleaver	UTSW	1	43978508	nonsense	probably null
Eddie	UTSW	1	43968988	missense	probably damaging	1.00
June	UTSW	1	43954710	missense	probably damaging	1.00
mathers	UTSW	1	43992268	missense	probably damaging	1.00
state	UTSW	1	43978438	missense	possibly damaging	0.48
wally	UTSW	1	43992396	critical splice donor site	probably null
Ward	UTSW	1	43954736	missense	possibly damaging	0.82
BB010:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
BB020:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R0001:Tpp2	UTSW	1	43971726	missense	probably benign	0.00
R0003:Tpp2	UTSW	1	43960139	missense	possibly damaging	0.94
R0066:Tpp2	UTSW	1	43981748	missense	possibly damaging	0.56
R0110:Tpp2	UTSW	1	43999693	missense	probably damaging	1.00
R0110:Tpp2	UTSW	1	43978504	missense	probably benign	0.00
R0167:Tpp2	UTSW	1	43970488	missense	probably benign	0.01
R0441:Tpp2	UTSW	1	43990562	missense	possibly damaging	0.85
R0520:Tpp2	UTSW	1	43990530	missense	probably damaging	1.00
R0639:Tpp2	UTSW	1	43975447	missense	probably benign	0.00
R1118:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1119:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1593:Tpp2	UTSW	1	43975433	missense	probably benign	0.01
R1702:Tpp2	UTSW	1	43990548	missense	probably damaging	0.99
R1756:Tpp2	UTSW	1	43978725	splice site	probably null
R2066:Tpp2	UTSW	1	43978438	missense	possibly damaging	0.48
R2171:Tpp2	UTSW	1	43957446	missense	probably benign	0.00
R2378:Tpp2	UTSW	1	43999765	missense	probably damaging	0.99
R2394:Tpp2	UTSW	1	43983186	missense	possibly damaging	0.83
R2507:Tpp2	UTSW	1	44001449	missense	probably benign	0.31
R2879:Tpp2	UTSW	1	43971623	missense	probably damaging	1.00
R3436:Tpp2	UTSW	1	43940144	missense	probably damaging	0.99
R4106:Tpp2	UTSW	1	44001457	missense	possibly damaging	0.71
R4658:Tpp2	UTSW	1	43954710	missense	probably damaging	1.00
R4760:Tpp2	UTSW	1	43971715	missense	probably benign	0.08
R4963:Tpp2	UTSW	1	43992268	missense	probably damaging	1.00
R5049:Tpp2	UTSW	1	44001473	missense	possibly damaging	0.46
R5073:Tpp2	UTSW	1	43954736	missense	possibly damaging	0.82
R6010:Tpp2	UTSW	1	43951213	critical splice donor site	probably null
R6118:Tpp2	UTSW	1	43940146	missense	probably damaging	1.00
R6169:Tpp2	UTSW	1	43983579	missense	probably damaging	0.99
R6236:Tpp2	UTSW	1	43977317	missense	probably benign	0.01
R6695:Tpp2	UTSW	1	43983276	missense	probably benign
R6845:Tpp2	UTSW	1	43978508	nonsense	probably null
R7054:Tpp2	UTSW	1	43983158	missense	probably damaging	1.00
R7094:Tpp2	UTSW	1	43968988	missense	probably damaging	1.00
R7223:Tpp2	UTSW	1	43968888	missense	probably damaging	1.00
R7316:Tpp2	UTSW	1	43970431	missense	probably benign	0.00
R7324:Tpp2	UTSW	1	43978778	missense	probably damaging	1.00
R7363:Tpp2	UTSW	1	43985422	missense	probably benign	0.00
R7454:Tpp2	UTSW	1	43954659	missense	probably benign	0.01
R7496:Tpp2	UTSW	1	43983517	missense	probably benign	0.09
R7699:Tpp2	UTSW	1	43970466	missense	probably benign
R7700:Tpp2	UTSW	1	43970466	missense	probably benign
R7804:Tpp2	UTSW	1	43983281	missense	probably benign	0.00
R7933:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R7979:Tpp2	UTSW	1	43940137	missense	probably benign	0.35
R8032:Tpp2	UTSW	1	43975468	missense	possibly damaging	0.82
R8101:Tpp2	UTSW	1	43970440	missense	probably damaging	1.00
R8245:Tpp2	UTSW	1	43983552	missense	probably damaging	1.00
R8314:Tpp2	UTSW	1	43934227	missense	probably benign	0.10
R8518:Tpp2	UTSW	1	43980385	missense	probably damaging	1.00
R8519:Tpp2	UTSW	1	43977205	critical splice acceptor site	probably null
R8529:Tpp2	UTSW	1	43983140	missense	probably benign
R8756:Tpp2	UTSW	1	43960135	nonsense	probably null
R8765:Tpp2	UTSW	1	43972689	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGAGCTGTATCCAGGGTAG -3'
(R):5'- CACTGTACATCAAGATACTGTCAC -3'

Sequencing Primer
(F):5'- CATAATGCACATGTTGGAATG -3'
(R):5'- GTCACATATACTCTTGATAAACCAGC -3'

Posted On

2017-10-10