Incidental Mutation 'R6155:Iftap'
ID 489499
Institutional Source Beutler Lab
Gene Symbol Iftap
Ensembl Gene ENSMUSG00000027165
Gene Name intraflagellar transport associated protein
Synonyms NWC, B230118H07Rik
MMRRC Submission 044302-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 101391124-101459376 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 101406355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090513] [ENSMUST00000099682] [ENSMUST00000111231] [ENSMUST00000128898] [ENSMUST00000160037] [ENSMUST00000160722] [ENSMUST00000177152]
AlphaFold Q9CQI4
Predicted Effect probably null
Transcript: ENSMUST00000090513
Predicted Effect probably null
Transcript: ENSMUST00000099682
Predicted Effect probably null
Transcript: ENSMUST00000111231
Predicted Effect probably benign
Transcript: ENSMUST00000128898
Predicted Effect probably benign
Transcript: ENSMUST00000136601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138903
Predicted Effect probably null
Transcript: ENSMUST00000160037
Predicted Effect probably null
Transcript: ENSMUST00000160722
Predicted Effect probably benign
Transcript: ENSMUST00000177152
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as a cellular interacting partner of non-structural protein 10 of the severe acute respiratory syndrome coronavirus (SARS-CoV). The encoded protein may function as a negative regulator of transcription. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous deletion of one of two alternative first exons and its promoter has no obvious phenotypic effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 105,111,510 (GRCm39) Y319C probably benign Het
Actn4 A C 7: 28,595,566 (GRCm39) I763S probably damaging Het
Actr8 G A 14: 29,700,546 (GRCm39) probably null Het
Adrb1 T C 19: 56,711,336 (GRCm39) L178P probably damaging Het
Afap1 A G 5: 36,092,953 (GRCm39) Y19C unknown Het
Ankrd36 A G 11: 5,637,442 (GRCm39) E1337G probably benign Het
Arl4a A C 12: 40,086,519 (GRCm39) V76G probably damaging Het
Bmp1 A T 14: 70,745,447 (GRCm39) I246K probably damaging Het
Camk4 A T 18: 33,072,500 (GRCm39) T18S unknown Het
Cep152 T C 2: 125,423,620 (GRCm39) H927R probably benign Het
Clca3a2 A G 3: 144,525,118 (GRCm39) I38T probably damaging Het
Clec2g A C 6: 128,957,236 (GRCm39) T54P probably damaging Het
Cox20 A G 1: 178,149,362 (GRCm39) E31G possibly damaging Het
Crispld1 T A 1: 17,823,241 (GRCm39) H407Q probably benign Het
Csmd1 T C 8: 15,953,231 (GRCm39) I3417V probably benign Het
Dhtkd1 A C 2: 5,915,170 (GRCm39) H700Q probably null Het
Dnah10 G A 5: 124,847,663 (GRCm39) V1516M probably damaging Het
Dnah10 A G 5: 124,862,239 (GRCm39) T2165A probably damaging Het
Dock2 C G 11: 34,244,123 (GRCm39) M1072I probably benign Het
F11 T A 8: 45,705,119 (GRCm39) T141S probably damaging Het
Gabra6 T A 11: 42,207,350 (GRCm39) I245F probably damaging Het
H2-T5 G A 17: 36,478,399 (GRCm39) A211V possibly damaging Het
Herc1 T A 9: 66,340,705 (GRCm39) C1685S possibly damaging Het
Il20 G T 1: 130,838,477 (GRCm39) D73E probably damaging Het
Ireb2 C A 9: 54,793,811 (GRCm39) P247Q probably damaging Het
Kcng3 T C 17: 83,895,807 (GRCm39) I220V probably benign Het
Lce1j T G 3: 92,696,379 (GRCm39) Q133P unknown Het
Lgals9 C T 11: 78,854,331 (GRCm39) A287T probably benign Het
Lrrc52 A G 1: 167,294,296 (GRCm39) probably benign Het
Map3k5 A T 10: 19,994,187 (GRCm39) H1027L probably benign Het
Morc3 A G 16: 93,659,313 (GRCm39) D407G possibly damaging Het
Myom1 T C 17: 71,415,690 (GRCm39) probably null Het
Ncapg2 T C 12: 116,401,631 (GRCm39) F673S possibly damaging Het
Ncoa6 T C 2: 155,249,368 (GRCm39) D1312G probably damaging Het
Nkx1-1 A T 5: 33,588,395 (GRCm39) F298I probably damaging Het
Npas2 G A 1: 39,326,557 (GRCm39) R14Q probably damaging Het
Npas4 C T 19: 5,036,898 (GRCm39) C422Y probably damaging Het
Or11h4 T C 14: 50,974,076 (GRCm39) D181G probably benign Het
Or2y11 T A 11: 49,443,411 (GRCm39) I279N possibly damaging Het
Or4c123 A G 2: 89,126,765 (GRCm39) L283S probably damaging Het
Or5p4 T C 7: 107,680,493 (GRCm39) V164A probably benign Het
Pcdhga4 T C 18: 37,819,546 (GRCm39) I365T probably damaging Het
Pear1 T A 3: 87,666,875 (GRCm39) T37S probably damaging Het
Pkn2 A T 3: 142,559,454 (GRCm39) F24I probably benign Het
Plcb3 G A 19: 6,943,533 (GRCm39) A122V probably damaging Het
Pnliprp1 T C 19: 58,718,565 (GRCm39) probably null Het
Pramel28 T A 4: 143,691,712 (GRCm39) H337L probably benign Het
Psmb3 T A 11: 97,603,278 (GRCm39) F164I probably damaging Het
Ptch2 T A 4: 116,954,105 (GRCm39) F45Y probably damaging Het
Ptpn23 C A 9: 110,216,849 (GRCm39) probably benign Het
Pusl1 A G 4: 155,975,005 (GRCm39) S199P probably damaging Het
Rasgrp2 C A 19: 6,452,531 (GRCm39) L35I probably damaging Het
Rictor T C 15: 6,823,458 (GRCm39) L1545P probably benign Het
Rtn4r A T 16: 17,969,258 (GRCm39) M229L probably benign Het
Ruvbl1 A T 6: 88,456,107 (GRCm39) probably null Het
Slc35b3 A T 13: 39,128,572 (GRCm39) S30T probably damaging Het
Sorcs3 T C 19: 48,387,136 (GRCm39) V207A possibly damaging Het
Sox13 A G 1: 133,321,005 (GRCm39) S2P probably damaging Het
Sptbn1 A C 11: 30,087,403 (GRCm39) L999R probably damaging Het
Taf4 A G 2: 179,555,317 (GRCm39) V1015A probably damaging Het
Top3b T C 16: 16,709,373 (GRCm39) L687P probably damaging Het
Tpp2 T A 1: 43,995,649 (GRCm39) V268E probably damaging Het
Ttc6 T C 12: 57,784,402 (GRCm39) Y1824H possibly damaging Het
Txk A G 5: 72,858,069 (GRCm39) Y360H probably damaging Het
Vmn2r57 T C 7: 41,078,114 (GRCm39) I115V probably benign Het
Vmn2r98 T C 17: 19,286,143 (GRCm39) S214P possibly damaging Het
Zbtb48 T C 4: 152,106,495 (GRCm39) probably null Het
Zzz3 A G 3: 152,133,319 (GRCm39) I126V possibly damaging Het
Other mutations in Iftap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03347:Iftap APN 2 101,413,864 (GRCm39) critical splice donor site probably null
IGL03384:Iftap APN 2 101,415,608 (GRCm39) missense probably benign 0.00
R0190:Iftap UTSW 2 101,416,775 (GRCm39) missense probably benign 0.16
R0436:Iftap UTSW 2 101,440,864 (GRCm39) splice site probably benign
R0591:Iftap UTSW 2 101,406,462 (GRCm39) missense probably benign 0.14
R0880:Iftap UTSW 2 101,406,455 (GRCm39) missense probably benign 0.32
R1608:Iftap UTSW 2 101,440,916 (GRCm39) missense probably damaging 1.00
R6008:Iftap UTSW 2 101,413,898 (GRCm39) missense possibly damaging 0.52
R6060:Iftap UTSW 2 101,440,950 (GRCm39) missense probably benign 0.06
R6805:Iftap UTSW 2 101,396,804 (GRCm39) missense probably benign 0.29
R7209:Iftap UTSW 2 101,396,727 (GRCm39) makesense probably null
R7258:Iftap UTSW 2 101,440,937 (GRCm39) missense probably null 0.96
R7680:Iftap UTSW 2 101,440,901 (GRCm39) missense probably damaging 1.00
R7898:Iftap UTSW 2 101,416,747 (GRCm39) missense probably benign 0.34
R8026:Iftap UTSW 2 101,400,989 (GRCm39) intron probably benign
R8688:Iftap UTSW 2 101,440,916 (GRCm39) missense probably damaging 1.00
Z1186:Iftap UTSW 2 101,440,950 (GRCm39) missense probably benign 0.06
Z1187:Iftap UTSW 2 101,440,950 (GRCm39) missense probably benign 0.06
Z1188:Iftap UTSW 2 101,440,950 (GRCm39) missense probably benign 0.06
Z1189:Iftap UTSW 2 101,440,950 (GRCm39) missense probably benign 0.06
Z1190:Iftap UTSW 2 101,440,950 (GRCm39) missense probably benign 0.06
Z1192:Iftap UTSW 2 101,440,950 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTGAGCAGTTCATATGCAGAAC -3'
(R):5'- CGAACTTCACAAGAGATCAGCTG -3'

Sequencing Primer
(F):5'- TGAGGTAAAACGTGCTTCTACAG -3'
(R):5'- CACAAGAGATCAGCTGAAATATTTTG -3'
Posted On 2017-10-10