Incidental Mutation 'R6155:Zzz3'
ID 489507
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Name zinc finger, ZZ domain containing 3
Synonyms 3110065C23Rik, 6430567E01Rik
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 152395473-152462826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152427682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 126 (I126V)
Ref Sequence ENSEMBL: ENSMUSP00000101707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
AlphaFold Q6KAQ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000089982
AA Change: I126V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: I126V

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106100
AA Change: I126V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: I126V

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106101
AA Change: I126V

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: I126V

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106103
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197987
Predicted Effect probably benign
Transcript: ENSMUST00000200570
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Bmp1 A T 14: 70,508,007 I246K probably damaging Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gabra6 T A 11: 42,316,523 I245F probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas2 G A 1: 39,287,476 R14Q probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Pusl1 A G 4: 155,890,548 S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Slc35b3 A T 13: 38,944,596 S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Taf4 A G 2: 179,913,524 V1015A probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Ttc6 T C 12: 57,737,616 Y1824H possibly damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Vmn2r98 T C 17: 19,065,881 S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 probably null Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R1706:Zzz3 UTSW 3 152449098 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R3927:Zzz3 UTSW 3 152455862 missense probably damaging 1.00
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R4768:Zzz3 UTSW 3 152448783 missense probably damaging 1.00
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R5884:Zzz3 UTSW 3 152450658 missense probably damaging 1.00
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R7732:Zzz3 UTSW 3 152448842 missense probably damaging 1.00
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8490:Zzz3 UTSW 3 152428653 nonsense probably null
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
R9143:Zzz3 UTSW 3 152458271 missense probably benign 0.04
R9243:Zzz3 UTSW 3 152428283 missense probably damaging 1.00
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGTGCCAACTCAGAAAGG -3'
(R):5'- TAAGTGGCCCTTCCTCACTGAC -3'

Sequencing Primer
(F):5'- GCCAACTCAGAAAGGAACCAATAATG -3'
(R):5'- CCTCACTGACATTCACCTTTTTAAC -3'
Posted On 2017-10-10