Mutagenetix > Incidental Mutations

Incidental Mutation 'R6155:Ruvbl1'

489518

Institutional Source

Beutler Lab

Gene Symbol

Ruvbl1

Ensembl Gene

ENSMUSG00000030079

Gene Name

RuvB-like protein 1

Synonyms

Tip49a, 2510009G06Rik, Pontin52

MMRRC Submission

044302-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88465409-88497572 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 88479125 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117925 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032165] [ENSMUST00000129035]

Predicted Effect

probably null
Transcript: ENSMUST00000032165

SMART Domains

Protein: ENSMUSP00000032165
Gene: ENSMUSG00000030079

Domain	Start	End	E-Value	Type
AAA	62	365	1.51e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000129035

SMART Domains

Protein: ENSMUSP00000117925
Gene: ENSMUSG00000030079

Domain	Start	End	E-Value	Type
Pfam:AAA_19	1	77	1.3e-7	PFAM
Pfam:TIP49	1	134	2.7e-60	PFAM
Pfam:RuvB_N	2	52	5.5e-7	PFAM
Pfam:AAA	6	80	1.5e-10	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has both DNA-dependent ATPase and DNA helicase activities and belongs to the ATPases associated with diverse cellular activities (AAA+) protein family. The encoded protein associates with several multisubunit transcriptional complexes and with protein complexes involved in both ATP-dependent remodeling and histone modification. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele show impaired proliferation of the pluripotent inner mass cells and embryonic lethality before implantation. Conditional ablation of this gene in hematopoietic tissues leads to bone marrow failure involving apoptotic loss of hematopoietic stem cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 104,963,644	Y319C	probably benign	Het
Actn4	A	C	7: 28,896,141	I763S	probably damaging	Het
Actr8	G	A	14: 29,978,589		probably null	Het
Adrb1	T	C	19: 56,722,904	L178P	probably damaging	Het
Afap1	A	G	5: 35,935,609	Y19C	unknown	Het
Ankrd36	A	G	11: 5,687,442	E1337G	probably benign	Het
Arl4a	A	C	12: 40,036,520	V76G	probably damaging	Het
B230118H07Rik	A	T	2: 101,576,010		probably null	Het
Bmp1	A	T	14: 70,508,007	I246K	probably damaging	Het
Camk4	A	T	18: 32,939,447	T18S	unknown	Het
Cep152	T	C	2: 125,581,700	H927R	probably benign	Het
Clca3a2	A	G	3: 144,819,357	I38T	probably damaging	Het
Clec2g	A	C	6: 128,980,273	T54P	probably damaging	Het
Cox20	A	G	1: 178,321,797	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,753,017	H407Q	probably benign	Het
Csmd1	T	C	8: 15,903,231	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,910,359	H700Q	probably null	Het
Dnah10	G	A	5: 124,770,599	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,785,175	T2165A	probably damaging	Het
Dock2	C	G	11: 34,294,123	M1072I	probably benign	Het
F11	T	A	8: 45,252,082	T141S	probably damaging	Het
Gabra6	T	A	11: 42,316,523	I245F	probably damaging	Het
Gm13101	T	A	4: 143,965,142	H337L	probably benign	Het
Gm8909	G	A	17: 36,167,507	A211V	possibly damaging	Het
Herc1	T	A	9: 66,433,423	C1685S	possibly damaging	Het
Il20	G	T	1: 130,910,740	D73E	probably damaging	Het
Ireb2	C	A	9: 54,886,527	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,588,378	I220V	probably benign	Het
Lce1j	T	G	3: 92,789,072	Q133P	unknown	Het
Lgals9	C	T	11: 78,963,505	A287T	probably benign	Het
Lrrc52	A	G	1: 167,466,727		probably benign	Het
Map3k5	A	T	10: 20,118,441	H1027L	probably benign	Het
Morc3	A	G	16: 93,862,425	D407G	possibly damaging	Het
Myom1	T	C	17: 71,108,695		probably null	Het
Ncapg2	T	C	12: 116,438,011	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,407,448	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,431,051	F298I	probably damaging	Het
Npas2	G	A	1: 39,287,476	R14Q	probably damaging	Het
Npas4	C	T	19: 4,986,870	C422Y	probably damaging	Het
Olfr1230	A	G	2: 89,296,421	L283S	probably damaging	Het
Olfr1381	T	A	11: 49,552,584	I279N	possibly damaging	Het
Olfr481	T	C	7: 108,081,286	V164A	probably benign	Het
Olfr749	T	C	14: 50,736,619	D181G	probably benign	Het
Pcdhga4	T	C	18: 37,686,493	I365T	probably damaging	Het
Pear1	T	A	3: 87,759,568	T37S	probably damaging	Het
Pkn2	A	T	3: 142,853,693	F24I	probably benign	Het
Plcb3	G	A	19: 6,966,165	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,730,133		probably null	Het
Psmb3	T	A	11: 97,712,452	F164I	probably damaging	Het
Ptch2	T	A	4: 117,096,908	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Pusl1	A	G	4: 155,890,548	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,402,501	L35I	probably damaging	Het
Rictor	T	C	15: 6,793,977	L1545P	probably benign	Het
Rtn4r	A	T	16: 18,151,394	M229L	probably benign	Het
Slc35b3	A	T	13: 38,944,596	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,398,697	V207A	possibly damaging	Het
Sox13	A	G	1: 133,393,267	S2P	probably damaging	Het
Sptbn1	A	C	11: 30,137,403	L999R	probably damaging	Het
Taf4	A	G	2: 179,913,524	V1015A	probably damaging	Het
Top3b	T	C	16: 16,891,509	L687P	probably damaging	Het
Tpp2	T	A	1: 43,956,489	V268E	probably damaging	Het
Ttc6	T	C	12: 57,737,616	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,700,726	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,428,690	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,065,881	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,022,038		probably null	Het
Zzz3	A	G	3: 152,427,682	I126V	possibly damaging	Het

Other mutations in Ruvbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Ruvbl1	APN	6	88484403	unclassified	probably benign
IGL00473:Ruvbl1	APN	6	88491568	missense	probably damaging	1.00
IGL01768:Ruvbl1	APN	6	88497271	missense	probably benign
IGL03354:Ruvbl1	APN	6	88479215	nonsense	probably null
R0106:Ruvbl1	UTSW	6	88473200	missense	probably damaging	1.00
R0106:Ruvbl1	UTSW	6	88473200	missense	probably damaging	1.00
R0145:Ruvbl1	UTSW	6	88484459	missense	possibly damaging	0.90
R0676:Ruvbl1	UTSW	6	88473200	missense	probably damaging	1.00
R1448:Ruvbl1	UTSW	6	88467569	missense	probably benign	0.05
R1561:Ruvbl1	UTSW	6	88479154	missense	probably damaging	1.00
R1574:Ruvbl1	UTSW	6	88479154	missense	probably damaging	1.00
R1623:Ruvbl1	UTSW	6	88485770	missense	probably damaging	1.00
R2113:Ruvbl1	UTSW	6	88483021	missense	probably damaging	0.99
R2372:Ruvbl1	UTSW	6	88485797	missense	possibly damaging	0.53
R2397:Ruvbl1	UTSW	6	88465552	missense	possibly damaging	0.71
R2894:Ruvbl1	UTSW	6	88479132	missense	possibly damaging	0.87
R4037:Ruvbl1	UTSW	6	88473135	missense	probably damaging	1.00
R4604:Ruvbl1	UTSW	6	88485905	missense	probably benign
R4684:Ruvbl1	UTSW	6	88491599	missense	probably benign	0.00
R4714:Ruvbl1	UTSW	6	88484430	missense	possibly damaging	0.61
R4835:Ruvbl1	UTSW	6	88497229	missense	possibly damaging	0.69
R4939:Ruvbl1	UTSW	6	88483039	splice site	probably null
R5114:Ruvbl1	UTSW	6	88497290	missense	probably benign	0.41
R5126:Ruvbl1	UTSW	6	88485901	missense	probably benign	0.13
R5296:Ruvbl1	UTSW	6	88485908	missense	probably damaging	0.99
R5507:Ruvbl1	UTSW	6	88467600	missense	probably benign	0.00
R5559:Ruvbl1	UTSW	6	88473096	missense	possibly damaging	0.90
R5819:Ruvbl1	UTSW	6	88483115	splice site	probably null
R6048:Ruvbl1	UTSW	6	88482991	missense	possibly damaging	0.90
R6564:Ruvbl1	UTSW	6	88479226	missense	possibly damaging	0.93
R6704:Ruvbl1	UTSW	6	88479205	missense	probably benign	0.06
R7681:Ruvbl1	UTSW	6	88467653	critical splice donor site	probably null
R8071:Ruvbl1	UTSW	6	88473126	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTTTGCACTTGTGGCTCTAC -3'
(R):5'- TCAGGACACCTTTCGCAGAG -3'

Sequencing Primer
(F):5'- GGCTCTACTGTTTTCTGTCCACAG -3'
(R):5'- GCAGTTAAGGTAAGAGCTCCACAC -3'

Posted On

2017-10-10