Mutagenetix > Incidental Mutation

Incidental Mutation 'R6155:Actn4'

489520

Institutional Source

Beutler Lab

Gene Symbol

Actn4

Ensembl Gene

ENSMUSG00000054808

Gene Name

actinin alpha 4

Synonyms

MMRRC Submission

044302-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.830) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

28893248-28962340 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 28896141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 763 (I763S)

Ref Sequence

ENSEMBL: ENSMUSP00000066068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066880] [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000217157]

AlphaFold

P57780

Predicted Effect

probably benign
Transcript: ENSMUST00000066880

SMART Domains

Protein: ENSMUSP00000069055
Gene: ENSMUSG00000054083

Domain	Start	End	E-Value	Type
CysPc	27	349	7.8e-139	SMART
calpain_III	353	529	7.47e-72	SMART
SCOP:d1alva_	552	720	3e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000068045
AA Change: I763S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808
AA Change: I763S

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
CH	53	153	1.08e-24	SMART
CH	166	265	3.49e-24	SMART
SPEC	297	403	2.83e0	SMART
SPEC	417	518	3.78e-23	SMART
SPEC	532	639	8.64e-9	SMART
SPEC	653	752	3.56e0	SMART
EFh	770	798	1.92e-3	SMART
EFh	811	839	1.56e-3	SMART
efhand_Ca_insen	842	908	1.27e-36	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127210

SMART Domains

Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
CH	53	153	1.08e-24	SMART
CH	166	265	1.03e-21	SMART
SPEC	297	403	2.83e0	SMART
SPEC	417	518	3.78e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129338

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144909

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207765

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208299

Predicted Effect

unknown
Transcript: ENSMUST00000216863
AA Change: I178S

Predicted Effect

probably damaging
Transcript: ENSMUST00000217157
AA Change: I763S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.8551

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 104,963,644	Y319C	probably benign	Het
Actr8	G	A	14: 29,978,589		probably null	Het
Adrb1	T	C	19: 56,722,904	L178P	probably damaging	Het
Afap1	A	G	5: 35,935,609	Y19C	unknown	Het
Ankrd36	A	G	11: 5,687,442	E1337G	probably benign	Het
Arl4a	A	C	12: 40,036,520	V76G	probably damaging	Het
B230118H07Rik	A	T	2: 101,576,010		probably null	Het
Bmp1	A	T	14: 70,508,007	I246K	probably damaging	Het
Camk4	A	T	18: 32,939,447	T18S	unknown	Het
Cep152	T	C	2: 125,581,700	H927R	probably benign	Het
Clca3a2	A	G	3: 144,819,357	I38T	probably damaging	Het
Clec2g	A	C	6: 128,980,273	T54P	probably damaging	Het
Cox20	A	G	1: 178,321,797	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,753,017	H407Q	probably benign	Het
Csmd1	T	C	8: 15,903,231	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,910,359	H700Q	probably null	Het
Dnah10	G	A	5: 124,770,599	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,785,175	T2165A	probably damaging	Het
Dock2	C	G	11: 34,294,123	M1072I	probably benign	Het
F11	T	A	8: 45,252,082	T141S	probably damaging	Het
Gabra6	T	A	11: 42,316,523	I245F	probably damaging	Het
Gm13101	T	A	4: 143,965,142	H337L	probably benign	Het
Gm8909	G	A	17: 36,167,507	A211V	possibly damaging	Het
Herc1	T	A	9: 66,433,423	C1685S	possibly damaging	Het
Il20	G	T	1: 130,910,740	D73E	probably damaging	Het
Ireb2	C	A	9: 54,886,527	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,588,378	I220V	probably benign	Het
Lce1j	T	G	3: 92,789,072	Q133P	unknown	Het
Lgals9	C	T	11: 78,963,505	A287T	probably benign	Het
Lrrc52	A	G	1: 167,466,727		probably benign	Het
Map3k5	A	T	10: 20,118,441	H1027L	probably benign	Het
Morc3	A	G	16: 93,862,425	D407G	possibly damaging	Het
Myom1	T	C	17: 71,108,695		probably null	Het
Ncapg2	T	C	12: 116,438,011	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,407,448	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,431,051	F298I	probably damaging	Het
Npas2	G	A	1: 39,287,476	R14Q	probably damaging	Het
Npas4	C	T	19: 4,986,870	C422Y	probably damaging	Het
Olfr1230	A	G	2: 89,296,421	L283S	probably damaging	Het
Olfr1381	T	A	11: 49,552,584	I279N	possibly damaging	Het
Olfr481	T	C	7: 108,081,286	V164A	probably benign	Het
Olfr749	T	C	14: 50,736,619	D181G	probably benign	Het
Pcdhga4	T	C	18: 37,686,493	I365T	probably damaging	Het
Pear1	T	A	3: 87,759,568	T37S	probably damaging	Het
Pkn2	A	T	3: 142,853,693	F24I	probably benign	Het
Plcb3	G	A	19: 6,966,165	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,730,133		probably null	Het
Psmb3	T	A	11: 97,712,452	F164I	probably damaging	Het
Ptch2	T	A	4: 117,096,908	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Pusl1	A	G	4: 155,890,548	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,402,501	L35I	probably damaging	Het
Rictor	T	C	15: 6,793,977	L1545P	probably benign	Het
Rtn4r	A	T	16: 18,151,394	M229L	probably benign	Het
Ruvbl1	A	T	6: 88,479,125		probably null	Het
Slc35b3	A	T	13: 38,944,596	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,398,697	V207A	possibly damaging	Het
Sox13	A	G	1: 133,393,267	S2P	probably damaging	Het
Sptbn1	A	C	11: 30,137,403	L999R	probably damaging	Het
Taf4	A	G	2: 179,913,524	V1015A	probably damaging	Het
Top3b	T	C	16: 16,891,509	L687P	probably damaging	Het
Tpp2	T	A	1: 43,956,489	V268E	probably damaging	Het
Ttc6	T	C	12: 57,737,616	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,700,726	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,428,690	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,065,881	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,022,038		probably null	Het
Zzz3	A	G	3: 152,427,682	I126V	possibly damaging	Het

Other mutations in Actn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Actn4	APN	7	28904684	missense	probably damaging	1.00
IGL02127:Actn4	APN	7	28897880	missense	probably benign
IGL02192:Actn4	APN	7	28898400	missense	possibly damaging	0.93
IGL02862:Actn4	APN	7	28912234	splice site	probably benign
IGL03339:Actn4	APN	7	28901982	missense	probably damaging	1.00
R0067:Actn4	UTSW	7	28911570	missense	possibly damaging	0.67
R0067:Actn4	UTSW	7	28911570	missense	possibly damaging	0.67
R0243:Actn4	UTSW	7	28905398	missense	probably benign	0.29
R0689:Actn4	UTSW	7	28897049	missense	probably damaging	1.00
R0845:Actn4	UTSW	7	28913430	missense	probably damaging	1.00
R1469:Actn4	UTSW	7	28905328	missense	probably benign	0.15
R1469:Actn4	UTSW	7	28898266	splice site	probably benign
R1469:Actn4	UTSW	7	28905328	missense	probably benign	0.15
R1581:Actn4	UTSW	7	28898646	missense	probably benign	0.04
R1690:Actn4	UTSW	7	28911525	missense	probably damaging	1.00
R1962:Actn4	UTSW	7	28894622	missense	probably damaging	1.00
R2113:Actn4	UTSW	7	28898124	missense	probably benign	0.42
R2215:Actn4	UTSW	7	28918753	missense	possibly damaging	0.88
R2429:Actn4	UTSW	7	28898071	missense	probably benign	0.00
R3945:Actn4	UTSW	7	28912236	splice site	probably null
R3962:Actn4	UTSW	7	28898222	splice site	probably null
R3970:Actn4	UTSW	7	28962032	missense	probably benign
R4909:Actn4	UTSW	7	28898657	missense	probably damaging	1.00
R4985:Actn4	UTSW	7	28918986	missense	probably damaging	1.00
R5155:Actn4	UTSW	7	28962017	critical splice donor site	probably null
R5201:Actn4	UTSW	7	28916255	splice site	probably null
R5668:Actn4	UTSW	7	28904550	missense	probably damaging	1.00
R5818:Actn4	UTSW	7	28919019	missense	probably damaging	1.00
R6046:Actn4	UTSW	7	28904619	missense	probably benign	0.03
R6559:Actn4	UTSW	7	28907036	missense	possibly damaging	0.87
R7224:Actn4	UTSW	7	28962084	missense	probably benign	0.08
R7225:Actn4	UTSW	7	28898699	missense	probably damaging	1.00
R7423:Actn4	UTSW	7	28894255	missense	probably damaging	0.97
R7665:Actn4	UTSW	7	28916207	missense	probably damaging	1.00
R7704:Actn4	UTSW	7	28897042	missense	possibly damaging	0.76
R8096:Actn4	UTSW	7	28894583	missense	possibly damaging	0.88
R8096:Actn4	UTSW	7	28901913	missense	probably damaging	1.00
R8954:Actn4	UTSW	7	28895158	missense	probably damaging	0.96
R8987:Actn4	UTSW	7	28896973	missense	probably benign	0.00
R9128:Actn4	UTSW	7	28894504	missense	possibly damaging	0.90
R9507:Actn4	UTSW	7	28906972	missense	probably benign	0.00
R9574:Actn4	UTSW	7	28895439	missense	probably benign	0.03
R9746:Actn4	UTSW	7	28919006	missense	probably benign
Z1088:Actn4	UTSW	7	28894578	missense	probably damaging	1.00
Z1177:Actn4	UTSW	7	28919049	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTGGCCTTGTGTGTACTC -3'
(R):5'- AAAAGTCCTGTGTCCCTTGTCAG -3'

Sequencing Primer
(F):5'- TGCCCATCATGAGGACAGTG -3'
(R):5'- CCCTTGTCAGTTGGTGAGATAC -3'

Posted On

2017-10-10