Incidental Mutation 'R6155:Vmn2r57'
ID 489521
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Name vomeronasal 2, receptor 57
Synonyms EG269902
MMRRC Submission 044302-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R6155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 41399732-41448641 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41428690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 115 (I115V)
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
AlphaFold L7N269
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably benign
Transcript: ENSMUST00000165029
AA Change: I115V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: I115V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 (GRCm38) Y319C probably benign Het
Actn4 A C 7: 28,896,141 (GRCm38) I763S probably damaging Het
Actr8 G A 14: 29,978,589 (GRCm38) probably null Het
Adrb1 T C 19: 56,722,904 (GRCm38) L178P probably damaging Het
Afap1 A G 5: 35,935,609 (GRCm38) Y19C unknown Het
Ankrd36 A G 11: 5,687,442 (GRCm38) E1337G probably benign Het
Arl4a A C 12: 40,036,520 (GRCm38) V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 (GRCm38) probably null Het
Bmp1 A T 14: 70,508,007 (GRCm38) I246K probably damaging Het
Camk4 A T 18: 32,939,447 (GRCm38) T18S unknown Het
Cep152 T C 2: 125,581,700 (GRCm38) H927R probably benign Het
Clca3a2 A G 3: 144,819,357 (GRCm38) I38T probably damaging Het
Clec2g A C 6: 128,980,273 (GRCm38) T54P probably damaging Het
Cox20 A G 1: 178,321,797 (GRCm38) E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 (GRCm38) H407Q probably benign Het
Csmd1 T C 8: 15,903,231 (GRCm38) I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 (GRCm38) H700Q probably null Het
Dnah10 A G 5: 124,785,175 (GRCm38) T2165A probably damaging Het
Dnah10 G A 5: 124,770,599 (GRCm38) V1516M probably damaging Het
Dock2 C G 11: 34,294,123 (GRCm38) M1072I probably benign Het
F11 T A 8: 45,252,082 (GRCm38) T141S probably damaging Het
Gabra6 T A 11: 42,316,523 (GRCm38) I245F probably damaging Het
Gm13101 T A 4: 143,965,142 (GRCm38) H337L probably benign Het
Gm8909 G A 17: 36,167,507 (GRCm38) A211V possibly damaging Het
Herc1 T A 9: 66,433,423 (GRCm38) C1685S possibly damaging Het
Il20 G T 1: 130,910,740 (GRCm38) D73E probably damaging Het
Ireb2 C A 9: 54,886,527 (GRCm38) P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 (GRCm38) I220V probably benign Het
Lce1j T G 3: 92,789,072 (GRCm38) Q133P unknown Het
Lgals9 C T 11: 78,963,505 (GRCm38) A287T probably benign Het
Lrrc52 A G 1: 167,466,727 (GRCm38) probably benign Het
Map3k5 A T 10: 20,118,441 (GRCm38) H1027L probably benign Het
Morc3 A G 16: 93,862,425 (GRCm38) D407G possibly damaging Het
Myom1 T C 17: 71,108,695 (GRCm38) probably null Het
Ncapg2 T C 12: 116,438,011 (GRCm38) F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 (GRCm38) D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 (GRCm38) F298I probably damaging Het
Npas2 G A 1: 39,287,476 (GRCm38) R14Q probably damaging Het
Npas4 C T 19: 4,986,870 (GRCm38) C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 (GRCm38) L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 (GRCm38) I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 (GRCm38) V164A probably benign Het
Olfr749 T C 14: 50,736,619 (GRCm38) D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 (GRCm38) I365T probably damaging Het
Pear1 T A 3: 87,759,568 (GRCm38) T37S probably damaging Het
Pkn2 A T 3: 142,853,693 (GRCm38) F24I probably benign Het
Plcb3 G A 19: 6,966,165 (GRCm38) A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 (GRCm38) probably null Het
Psmb3 T A 11: 97,712,452 (GRCm38) F164I probably damaging Het
Ptch2 T A 4: 117,096,908 (GRCm38) F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 (GRCm38) probably benign Het
Pusl1 A G 4: 155,890,548 (GRCm38) S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 (GRCm38) L35I probably damaging Het
Rictor T C 15: 6,793,977 (GRCm38) L1545P probably benign Het
Rtn4r A T 16: 18,151,394 (GRCm38) M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 (GRCm38) probably null Het
Slc35b3 A T 13: 38,944,596 (GRCm38) S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 (GRCm38) V207A possibly damaging Het
Sox13 A G 1: 133,393,267 (GRCm38) S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 (GRCm38) L999R probably damaging Het
Taf4 A G 2: 179,913,524 (GRCm38) V1015A probably damaging Het
Top3b T C 16: 16,891,509 (GRCm38) L687P probably damaging Het
Tpp2 T A 1: 43,956,489 (GRCm38) V268E probably damaging Het
Ttc6 T C 12: 57,737,616 (GRCm38) Y1824H possibly damaging Het
Txk A G 5: 72,700,726 (GRCm38) Y360H probably damaging Het
Vmn2r98 T C 17: 19,065,881 (GRCm38) S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 (GRCm38) probably null Het
Zzz3 A G 3: 152,427,682 (GRCm38) I126V possibly damaging Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41,428,785 (GRCm38) missense probably benign
IGL01108:Vmn2r57 APN 7 41,427,584 (GRCm38) missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41,425,043 (GRCm38) missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41,399,946 (GRCm38) missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41,400,195 (GRCm38) missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41,400,450 (GRCm38) missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41,428,226 (GRCm38) missense probably benign
IGL02801:Vmn2r57 APN 7 41,448,632 (GRCm38) missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41,428,074 (GRCm38) missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41,399,741 (GRCm38) missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41,400,652 (GRCm38) missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41,399,733 (GRCm38) splice site probably null
R0305:Vmn2r57 UTSW 7 41,427,543 (GRCm38) missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41,427,792 (GRCm38) missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41,427,792 (GRCm38) missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41,428,801 (GRCm38) missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41,427,804 (GRCm38) missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41,428,211 (GRCm38) missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41,427,830 (GRCm38) missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41,400,124 (GRCm38) missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41,400,643 (GRCm38) missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41,428,107 (GRCm38) missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41,448,577 (GRCm38) missense probably benign 0.00
R2197:Vmn2r57 UTSW 7 41,428,825 (GRCm38) critical splice acceptor site probably null
R2242:Vmn2r57 UTSW 7 41,428,074 (GRCm38) missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41,400,195 (GRCm38) missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41,428,130 (GRCm38) missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41,428,239 (GRCm38) missense probably benign
R4423:Vmn2r57 UTSW 7 41,426,640 (GRCm38) missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41,400,468 (GRCm38) missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41,400,495 (GRCm38) missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41,428,662 (GRCm38) missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41,426,550 (GRCm38) critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41,400,240 (GRCm38) missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41,427,939 (GRCm38) missense probably damaging 0.96
R5289:Vmn2r57 UTSW 7 41,399,974 (GRCm38) missense probably damaging 0.99
R5745:Vmn2r57 UTSW 7 41,448,471 (GRCm38) missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41,448,472 (GRCm38) missense probably benign 0.00
R6248:Vmn2r57 UTSW 7 41,399,860 (GRCm38) missense probably benign
R6381:Vmn2r57 UTSW 7 41,428,818 (GRCm38) missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41,428,665 (GRCm38) missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41,399,794 (GRCm38) missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41,448,471 (GRCm38) missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41,400,286 (GRCm38) missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41,426,724 (GRCm38) missense probably benign 0.01
R7633:Vmn2r57 UTSW 7 41,425,089 (GRCm38) missense possibly damaging 0.76
R7811:Vmn2r57 UTSW 7 41,425,015 (GRCm38) nonsense probably null
R8025:Vmn2r57 UTSW 7 41,426,759 (GRCm38) missense probably benign 0.00
R8332:Vmn2r57 UTSW 7 41,400,253 (GRCm38) missense probably benign 0.01
R8345:Vmn2r57 UTSW 7 41,427,544 (GRCm38) missense possibly damaging 0.81
R8360:Vmn2r57 UTSW 7 41,400,216 (GRCm38) missense probably damaging 1.00
R8738:Vmn2r57 UTSW 7 41,427,596 (GRCm38) missense probably benign 0.00
R8758:Vmn2r57 UTSW 7 41,428,739 (GRCm38) missense probably damaging 1.00
R8955:Vmn2r57 UTSW 7 41,400,147 (GRCm38) missense possibly damaging 0.64
R8985:Vmn2r57 UTSW 7 41,399,835 (GRCm38) missense probably benign
R9108:Vmn2r57 UTSW 7 41,428,768 (GRCm38) missense possibly damaging 0.87
R9160:Vmn2r57 UTSW 7 41,426,735 (GRCm38) missense possibly damaging 0.48
R9354:Vmn2r57 UTSW 7 41,400,239 (GRCm38) missense probably benign 0.01
R9566:Vmn2r57 UTSW 7 41,427,665 (GRCm38) missense probably benign 0.32
R9633:Vmn2r57 UTSW 7 41,426,582 (GRCm38) missense probably benign 0.00
X0026:Vmn2r57 UTSW 7 41,428,561 (GRCm38) missense possibly damaging 0.91
X0026:Vmn2r57 UTSW 7 41,428,125 (GRCm38) missense probably benign 0.03
X0065:Vmn2r57 UTSW 7 41,427,971 (GRCm38) missense probably benign 0.09
Z1176:Vmn2r57 UTSW 7 41,400,498 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCTACTGCTCACCTGTGG -3'
(R):5'- ACTGATAGGCCAAGATTCAAGG -3'

Sequencing Primer
(F):5'- ACTGCTCACCTGTGGTATTTTG -3'
(R):5'- GGCCAAGATTCAAGGACTAAATATTC -3'
Posted On 2017-10-10