Mutagenetix > Incidental Mutation

Incidental Mutation 'R6155:Map3k5'

489528

Institutional Source

Beutler Lab

Gene Symbol

Map3k5

Ensembl Gene

ENSMUSG00000071369

Gene Name

mitogen-activated protein kinase kinase kinase 5

Synonyms

ASK, ASK1, 7420452D20Rik, Mekk5

MMRRC Submission

044302-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19934472-20142753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20118441 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1027 (H1027L)

Ref Sequence

ENSEMBL: ENSMUSP00000112864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259]

AlphaFold

O35099

Predicted Effect

probably benign
Transcript: ENSMUST00000095806
AA Change: H1035L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369
AA Change: H1035L

Domain	Start	End	E-Value	Type
low complexity region	26	43	N/A	INTRINSIC
low complexity region	44	58	N/A	INTRINSIC
low complexity region	80	99	N/A	INTRINSIC
Pfam:DUF4071	172	552	2.1e-162	PFAM
S_TKc	687	945	8.08e-92	SMART
low complexity region	1195	1207	N/A	INTRINSIC
low complexity region	1225	1238	N/A	INTRINSIC
coiled coil region	1251	1292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120259
AA Change: H1027L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369
AA Change: H1027L

Domain	Start	End	E-Value	Type
low complexity region	26	43	N/A	INTRINSIC
low complexity region	44	58	N/A	INTRINSIC
low complexity region	80	99	N/A	INTRINSIC
Pfam:DUF4071	172	544	1.7e-156	PFAM
S_TKc	679	937	8.08e-92	SMART
low complexity region	1187	1199	N/A	INTRINSIC
low complexity region	1217	1230	N/A	INTRINSIC
coiled coil region	1243	1284	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 104,963,644	Y319C	probably benign	Het
Actn4	A	C	7: 28,896,141	I763S	probably damaging	Het
Actr8	G	A	14: 29,978,589		probably null	Het
Adrb1	T	C	19: 56,722,904	L178P	probably damaging	Het
Afap1	A	G	5: 35,935,609	Y19C	unknown	Het
Ankrd36	A	G	11: 5,687,442	E1337G	probably benign	Het
Arl4a	A	C	12: 40,036,520	V76G	probably damaging	Het
B230118H07Rik	A	T	2: 101,576,010		probably null	Het
Bmp1	A	T	14: 70,508,007	I246K	probably damaging	Het
Camk4	A	T	18: 32,939,447	T18S	unknown	Het
Cep152	T	C	2: 125,581,700	H927R	probably benign	Het
Clca3a2	A	G	3: 144,819,357	I38T	probably damaging	Het
Clec2g	A	C	6: 128,980,273	T54P	probably damaging	Het
Cox20	A	G	1: 178,321,797	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,753,017	H407Q	probably benign	Het
Csmd1	T	C	8: 15,903,231	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,910,359	H700Q	probably null	Het
Dnah10	G	A	5: 124,770,599	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,785,175	T2165A	probably damaging	Het
Dock2	C	G	11: 34,294,123	M1072I	probably benign	Het
F11	T	A	8: 45,252,082	T141S	probably damaging	Het
Gabra6	T	A	11: 42,316,523	I245F	probably damaging	Het
Gm13101	T	A	4: 143,965,142	H337L	probably benign	Het
Gm8909	G	A	17: 36,167,507	A211V	possibly damaging	Het
Herc1	T	A	9: 66,433,423	C1685S	possibly damaging	Het
Il20	G	T	1: 130,910,740	D73E	probably damaging	Het
Ireb2	C	A	9: 54,886,527	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,588,378	I220V	probably benign	Het
Lce1j	T	G	3: 92,789,072	Q133P	unknown	Het
Lgals9	C	T	11: 78,963,505	A287T	probably benign	Het
Lrrc52	A	G	1: 167,466,727		probably benign	Het
Morc3	A	G	16: 93,862,425	D407G	possibly damaging	Het
Myom1	T	C	17: 71,108,695		probably null	Het
Ncapg2	T	C	12: 116,438,011	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,407,448	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,431,051	F298I	probably damaging	Het
Npas2	G	A	1: 39,287,476	R14Q	probably damaging	Het
Npas4	C	T	19: 4,986,870	C422Y	probably damaging	Het
Olfr1230	A	G	2: 89,296,421	L283S	probably damaging	Het
Olfr1381	T	A	11: 49,552,584	I279N	possibly damaging	Het
Olfr481	T	C	7: 108,081,286	V164A	probably benign	Het
Olfr749	T	C	14: 50,736,619	D181G	probably benign	Het
Pcdhga4	T	C	18: 37,686,493	I365T	probably damaging	Het
Pear1	T	A	3: 87,759,568	T37S	probably damaging	Het
Pkn2	A	T	3: 142,853,693	F24I	probably benign	Het
Plcb3	G	A	19: 6,966,165	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,730,133		probably null	Het
Psmb3	T	A	11: 97,712,452	F164I	probably damaging	Het
Ptch2	T	A	4: 117,096,908	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,387,781		probably benign	Het
Pusl1	A	G	4: 155,890,548	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,402,501	L35I	probably damaging	Het
Rictor	T	C	15: 6,793,977	L1545P	probably benign	Het
Rtn4r	A	T	16: 18,151,394	M229L	probably benign	Het
Ruvbl1	A	T	6: 88,479,125		probably null	Het
Slc35b3	A	T	13: 38,944,596	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,398,697	V207A	possibly damaging	Het
Sox13	A	G	1: 133,393,267	S2P	probably damaging	Het
Sptbn1	A	C	11: 30,137,403	L999R	probably damaging	Het
Taf4	A	G	2: 179,913,524	V1015A	probably damaging	Het
Top3b	T	C	16: 16,891,509	L687P	probably damaging	Het
Tpp2	T	A	1: 43,956,489	V268E	probably damaging	Het
Ttc6	T	C	12: 57,737,616	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,700,726	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,428,690	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,065,881	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,022,038		probably null	Het
Zzz3	A	G	3: 152,427,682	I126V	possibly damaging	Het

Other mutations in Map3k5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Map3k5	APN	10	19935044	missense	possibly damaging	0.73
IGL00978:Map3k5	APN	10	20141567	missense	probably damaging	1.00
IGL01470:Map3k5	APN	10	20118187	missense	possibly damaging	0.89
IGL01992:Map3k5	APN	10	20029133	nonsense	probably null
IGL02479:Map3k5	APN	10	20056484	missense	probably damaging	1.00
IGL02728:Map3k5	APN	10	20118292	missense	possibly damaging	0.71
IGL02812:Map3k5	APN	10	20025036	missense	probably damaging	1.00
IGL03104:Map3k5	APN	10	20132055	missense	probably benign
P0033:Map3k5	UTSW	10	20132213	splice site	probably benign
PIT4434001:Map3k5	UTSW	10	20026257	missense	probably damaging	0.98
R0284:Map3k5	UTSW	10	20000613	missense	probably damaging	0.99
R1103:Map3k5	UTSW	10	20023676	missense	probably benign	0.00
R1172:Map3k5	UTSW	10	20056648	intron	probably benign
R1250:Map3k5	UTSW	10	20110775	missense	possibly damaging	0.73
R1493:Map3k5	UTSW	10	20029113	missense	probably damaging	1.00
R1634:Map3k5	UTSW	10	20136911	missense	possibly damaging	0.64
R1693:Map3k5	UTSW	10	20104242	missense	probably damaging	1.00
R1713:Map3k5	UTSW	10	20110847	missense	possibly damaging	0.79
R1832:Map3k5	UTSW	10	20099560	missense	probably damaging	1.00
R1844:Map3k5	UTSW	10	20104163	missense	probably benign	0.33
R1869:Map3k5	UTSW	10	20132109	nonsense	probably null
R2156:Map3k5	UTSW	10	20024937	missense	probably damaging	1.00
R2214:Map3k5	UTSW	10	20026289	critical splice donor site	probably null
R2221:Map3k5	UTSW	10	20067920	missense	possibly damaging	0.96
R2223:Map3k5	UTSW	10	20067920	missense	possibly damaging	0.96
R2249:Map3k5	UTSW	10	20127697	missense	probably damaging	0.99
R2418:Map3k5	UTSW	10	20110857	missense	probably benign	0.02
R2513:Map3k5	UTSW	10	20094455	missense	possibly damaging	0.92
R3014:Map3k5	UTSW	10	20094429	missense	probably damaging	1.00
R3770:Map3k5	UTSW	10	20025019	missense	probably damaging	0.99
R3814:Map3k5	UTSW	10	20026190	missense	probably damaging	0.99
R3814:Map3k5	UTSW	10	20140680	missense	probably damaging	0.99
R4706:Map3k5	UTSW	10	20058938	missense	probably damaging	1.00
R4749:Map3k5	UTSW	10	20132052	missense	probably benign	0.42
R4903:Map3k5	UTSW	10	20118489	missense	probably null	1.00
R4958:Map3k5	UTSW	10	20023789	missense	possibly damaging	0.79
R5065:Map3k5	UTSW	10	20082467	missense	probably damaging	1.00
R5210:Map3k5	UTSW	10	20024901	missense	possibly damaging	0.82
R5245:Map3k5	UTSW	10	20140691	missense	probably benign	0.00
R5304:Map3k5	UTSW	10	20108238	missense	probably benign	0.13
R5428:Map3k5	UTSW	10	20023653	missense	possibly damaging	0.93
R5566:Map3k5	UTSW	10	20110719	missense	probably damaging	1.00
R5914:Map3k5	UTSW	10	20104255	missense	probably benign	0.24
R6161:Map3k5	UTSW	10	20000575	missense	probably damaging	0.98
R6191:Map3k5	UTSW	10	20023669	missense	probably damaging	0.99
R6251:Map3k5	UTSW	10	20138260	splice site	probably null
R6800:Map3k5	UTSW	10	20141580	makesense	probably null
R7304:Map3k5	UTSW	10	20099555	missense	probably damaging	1.00
R7722:Map3k5	UTSW	10	20132145	missense	probably benign	0.04
R8058:Map3k5	UTSW	10	20132114	missense	probably damaging	0.99
R8207:Map3k5	UTSW	10	20110866	frame shift	probably null
R8827:Map3k5	UTSW	10	20026257	missense	probably damaging	0.98
R8977:Map3k5	UTSW	10	20079254	missense	possibly damaging	0.88
R9490:Map3k5	UTSW	10	20132051	missense	probably benign
R9570:Map3k5	UTSW	10	20000568	missense	probably benign	0.02
R9784:Map3k5	UTSW	10	19935066	missense	probably damaging	1.00
RF024:Map3k5	UTSW	10	20100172	missense	probably damaging	1.00
X0017:Map3k5	UTSW	10	20118434	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGATACAGAGCTGAAGGC -3'
(R):5'- TCCTATGTAAATCTTCAGGAAGGGG -3'

Sequencing Primer
(F):5'- TTCTCCTTCAAAGCCAGAGC -3'
(R):5'- GGTGTCCAGGAAGCTTTACC -3'

Posted On

2017-10-10